Generation of the knockout cell line (ZAK and RACK1 knockout)
HEK293T RACK1-knockout cells were generated by CRISPR–Cas9 (refs. 51,52). The single guide RNA (sgRNA; ZAK target sequence: TGTATGGTTATGGAACCGAG; RACK1 target sequence ACTGCGGGGTAGTAGCGATCTGG) was subcloned into the pX330 plasmid51. HEK293T cells (American Type Culture Collection CRL-3216) were transfected with 1.5 µg of plasmid using Lipofectamine 3000 (L3000075, Thermo) according to the manufacturer’s instructions. After 2 days, cells were collected and plated on 96-well plates (3603, Corning) by limiting dilution. Colonies were confirmed for ZAK or RACK1 deletion by immunoblotting and sequencing.
Tissue culture
HEK293T cells were maintained using Dulbecco’s modified eagle medium (DMEM; 11995073, Thermo) supplemented with 10% FBS (A3160502, Thermo Fisher) and passed using trypsin-EDTA (0.25%) and phenol red (25200114, Thermo). Cells were seeded at 2 × 106 (15 cm; CLS430599, Millipore Sigma), 1.5 × 106 (10 cm; CLS430167, Corning) or 3 × 105 cells per well (six well; 3516, Fisher). At 24 h, cells were transfected using Lipofectamine 3000 Transfection Reagent (L3000075, Thermo) according to the manufacturer’s instructions. Twenty-four hours post-transfection, cells were treated and lysed (approximately 70% confluency). Medium was changed 1–2 h before drug treatment and/or lysis. ANS (A9789, Sigma) was added directly to the media (untreated = DMSO (D12345, Thermo); ANS collision dose = 0.38 µM final concentration). ANS stock solutions were 94.2 mM (25 mg ml−1) in DMSO. Unless noted, all ANS treatments were done for 15 min. For the protein stabilization experiments, medium was supplemented with 2 µM MLN4924 (B1036, ApexBio) or 2 µM nilotonib (A8232, ApexBio) from the time of transfection to time of harvesting (24 h). To end any treatment, medium was aspirated and cells were quickly washed with ice-cold PBS (10010-049, Thermo; 8 ml for 10 cm; 2 ml for six well) and then the lysis buffer (50 mM HEPES pH 7.5, 100 mM KOAc, 5% glycerol (G33-4, Fisher), 0.5% Triton X-100 (T9284, Millipore Sigma), 15 mM Mg(OAc) 2 , 1× Halt protease + phosphatase inhibitor cocktail (78445, Thermo Fisher) and Turbo DNase I (80 units; AM2239, Thermo)) was directly added to plates and the cells were collected by scraping. Plates (10 cm) were lysed in 200 µl lysis buffer; six-well dishes were lysed in 100 µl lysis buffer. Lysates were kept on ice and clarified at 8,500g for 5 min. Clarified lysates were flash frozen in N 2 and stored at −80 °C.
RNA knockdowns
Cells were seeded at 1 × 106 cells (10 cm) and 7.5 × 104 (six well). After 24 h, cells were treated with siRNA (50 µM stocks, 50 nM final concentration) using Lipofectamine RNAiMAX Transfection Reagent (13778150, Thermo) according to the manufacturer’s instructions. After 24 h, the medium was changed. Seventy-two hours post-siRNA transfection, cells were treated and lysed according to the above lysis protocol.
Sucrose gradients
Preparative (12 ml) sucrose gradients were made using 10× gradient buffer (250 mM HEPES pH 7.5, 1 M KOAc and 50 mM Mg(OAc) 2 ) to make final gradients with sucrose buffer (1× gradient buffer, 10% or 50% sucrose (60% sucrose stock), 1 mM TCEP (TCEP25, Gold-Bio) and SuperaseIN (200 units)). Approximately 25–50 µg RNA (quantified by qubit HS) was loaded on gradients in 200–300 µl final volume. The Beckman Coulter Ultracentrifuge and Beckman SW41 swinging bucket rotor were used for centrifugation. For regular gradients (10–50% sucrose), spins were done at 274,000g for 1 h 45 min at 4 °C. Ten fractions were collected and absorbance at 260 nm (A 260 ) was measured using the Biocomp Piston Gradient Fractionator. Trichloroacetic acid (TCA; T3699, Millipore Sigma) was added to each fraction (10% final concentration). Samples were frozen at −20 °C overnight. The TCA precipitation protocol followed.
Analytical (200 µl) gradients were made by stacking 40 µl of 50%, 40%, 30%, 20% and 10% sucrose buffer in 250 µl tubes (343775, Beckman). Approximately 1–2 µg RNA (quantified by qubit or normalized by bicinchoninic acid (BCA)) was loaded in 10 µl final volume on a 10–50% 200 µl gradient. The Beckman Coulter Tabletop Centrifuge (CTZ24D006, Optima MAX) and TLS55 rotor were used for centrifugation. Spins were done at 214,000g for 22 min at 4 °C. Ten 20 µl fractions were taken and added directly to 7 µl of 4× loading buffer. Of each fraction, 8 µl was run on 4–20% TGX 26-well gel (5671095, Bio-Rad).
Immunoblotting
... continue reading