Husbandry of experimental animals
Female frog (X. laevis) adults and zebrafish adults were maintained and handled according to established protocols43,44. Frogs were acquired from Nasco (LM00531) and Xenopus1 (4800). The experiments were approved and licensed by the local animal ethics committee (Landesdirektion Sachsen; license no. DD24-5131/367/9, 25-5131/521/12 and 25-5131/564/25 for frogs and license no. DD24.1-5131/394/33 for zebrafish) and carried out following the European Communities Council Directive 2010/63/EU on the protection of animals used for scientific purposes, as well as the German Animal Welfare Act. Drosophila stocks were maintained at room temperature using standard methods.
Zebrafish and Drosophila transgenic lines used
The following transgenic zebrafish lines were used. Tg(actb2:EGFP-Hsa.DCX) for microtubule visualization, Tg2(actb2:mCherry-Hsa.UTRN) for actin visualization, their double-transgenic Tg(actb2:EGFP-Hsa.DCX; actb2:mCherry-Hsa.UTRN) and Tg(Xla.Eef1a1:mlsEGFP)45 for mitochondrial compartmentalization. The following fly lines were used. For transgenics: wild-type (w[1118]), Pw[+mC]=PTT-GAJupiter[G00147] (BDSC 6836; FlyBase: FBst0006836) expressing Jupiter–GFP, Pw[+mC]=His2Av-mRFPII.2* (BDSC 23651; FlyBase: FBst0023651) expressing histone–RFP, and w[1118]; Pw[+mC]=osk-GAL4::VP16F/TM3, Sb[1] (BDSC 44242; FlyBase: FBst0044242), used as a maternal Gal4 driver for UAS lines. A double-transgenic line (yw; His2Av-EGFP/CyO; TMBD-mCherry/TM6B, Tb) was used to visualize histones and microtubules. A EB1–GFP line w[1118]; Pw[+mC]=ncd-EB1.GFPM1F3 (BDSC 57327; FlyBase: FBst0057327) was used to track EB1 comets. A photoconvertible α-tubulin under UAS line was used for photoconversion: w[*]; Pw[+mC]=UASp-alphaTub84B.tdEOS7M (BDSC 51314; FlyBase: FBst0051314).
Cytoplasmic extract and cell-cycle manipulations
Cytoplasmic extracts from frog eggs were prepared following standard protocols46,47. The following buffers were prepared in advance: Ten times Marc’s modified Ringer’s (MMR; 1 M NaCl, 20 mM KCl, 10 mM MgCl 2 , 20 mM CaCl 2 , 1 mM EDTA and 50 mM HEPES in milliQ water), with pH was adjusted to 7.8 with NaOH and the solution was filter sterilized and stored at room temperature; 20× Xenopus buffer (2 M KCl, 20 mM MgCl 2 and 2 mM CaCl 2 in MilliQ water), with pH adjusted to 7.7 with KOH; 1 M HEPES solution was prepared and pH was adjusted to 7.7 and after filter sterilization, the solution was stored at 4 °C; and a 2 M sucrose solution. The solutions were filter sterilized and stored at 4 °C. Female adult frogs were injected with 0.5 ml of pregnant mare serum gonadotropin (779-675, Covetrus) and 0.5 ml of human chorionic gonadotropin (CG10-10VL, Sigma) 3–8 days and 1 day before the experiment, respectively. After the second injection, frogs were incubated at 16 °C for 18 h in a 1× MMR solution. Of MilliQ water, 3 l was incubated at 16 °C to be used for buffer preparation. On the experiment day, the following buffers were prepared: 1 l of dejelly buffer (20 g of L-cysteine (W326305, Merck), 50 ml of 20× Xenopus buffer and MilliQ water), with pH adjusted to 7.8 with NaOH; 1 l of 0.2× MMR, with pH adjusted to 7.8 with NaOH; 1 l of 1× Xenopus buffer (20× Xenopus buffer in MilliQ, 50 mM sucrose, 10 mM 1× HEPES), with pH adjusted to 7.7 with KOH; 100 ml of calcium ionophore solution (CaIo; 5 µl of calcium ionophore (A23187, Sigma) in 100 ml of 0.2 MMR buffer); Xenopus buffer+ (100 µl of 10 mg ml−1 solution of leupeptin (15483809, Thermo Scientific), pepstatin (2936.2, Roth) and chymostatin (230790, Calbiochem) in 1× Xenopus buffer). Frog eggs were dejellyed by multiple washes with the dejelly buffer. Eggs were then washed multiple times with 1 l of 0.2 MMR buffer and then incubated in the CaIo solution to activate the cell cycle. During the dejelly and activation, eggs were swirled to achieve uniform contact with chemicals and avoid egg aggregation. The activation process lasted 3–5 min, depending on egg number, and was continued until the animal pole became smaller and darker. The eggs were then washed multiple times with 1 l of Xenopus buffer and then 3× with 250 ml of Xenopus buffer+. Next, eggs were transferred to centrifuge tubes (344057, Beckman) containing 1 ml Xenopus buffer+ and 10 µl of cytochalasin B (15466849, Thermo Scientific). Tubes were sequentially centrifuged for 30 s at 500 RPM and for 1.5 min at 2,000 RPM for egg packing. After the excess buffer was removed with an aspirator, eggs were crushed by centrifugation for 15 min at 10,000 RPM at 4 °C. The centrifuge tubes were placed on ice and the cytoplasmic layer was collected by puncturing the tube. Additional LPC (leupeptin–pepstatin–chymostatin) (1/1,000 w/v) and cytochalasin B (1/1,000 w/v) were added to further prevent protein degradation and actin polymerization. The extract was stored in ice and used on the same day. Interphase-arrested extract was obtained as described above but 200 µl of cycloheximide (239763, Merck; 10 mg ml−1) were added to the centrifuge tubes with the Xenopus buffer+.
Extract sample preparation and imaging
The extract was supplemented with de-membraneted sperm to induce nuclei formation and fluorescent labels for visualizing cellular structures. Reactions were set up by mixing 25 µl of undiluted extract, 0.6 µM pig tubulin labelled with 647 Alexa fluorophore48, 0.12 mg ml−1 GFP-NLS, 0.2 µl of 1:250 diluted stock in water of octadecyl rhodamine B chloride (O246, Invitrogen) and 1 µl of sperm (3,000 sperm per microlitre) in an Eppendorf tube in ice. Reactions were supplemented with the following: anti-INCENP (0.5 µl of antibody (ab12183, abcam) labelled with Alexa Fluor 488 NHS Ester (A20000, Thermo Fisher) instead of GFP-NLS), AurkA beads (1 µl)30, Ran(Q69L)16 (30 µM), MCAK-Q710 (1 µl of 1.5 mg ml−1 added). Dynein inhibitor p150-cc1 (concentrations reported in Extended Data Figs. 4 and 5), barasertib (40 µM; S1147, Selleckchem), purified centrosomes from Droosophila embryos (HisGFP-TauMCherry line) and HeLa cells were prepared using existing protocols49,50 (3 µl added to the reaction). The treatment with morpholino to selectively block translation of cyclin B1 and B2 and arrest the cell cycle was performed by mixing 2.5 µl of each the following morpholinos in a solution and then adding 1–5 µl of it to the extract reaction: morpholino anti-Xenopus cyclin B1 (ccnb1a): ACATTTTCCCAAAACCGACAACTGG; morpholino anti-Xenopus cyclin B1 (ccnb1b): ACATTTTCTCAAGCGCAAACCTGCA; morpholino anti-Xenopus cyclin B2 (ccnb2l): AATTGCAGCCCGACGAGTAGCCAT; and morpholino anti-Xenopus cyclin B2 (ccnb2s): CGACGAGTAGCCATCTCCGGTAAAA. The morpholinos were acquired by custom order to Gene Tools and the sequences were chosen from previous works27,28. For slowing the cell cycle, extract reactions were supplemented with 4 µl of cycloheximide in varying concentrations from 2.5 g l−1 to 7.5 g l−1. We could not link a specific concentration to a cell-cycle duration, probably because the amounts of cyclins vary from sample to sample. In all the experiments, the reactions were flicked multiple times and left for 3–5 min in ice to homogeneously distribute the reagents in the extract. Of the reaction, 6 µl was taken from ice, and added either on a 35-mm glass bottom dish (P35G-0.170-14-c, MatTek) and covered with 1 ml of mineral oil (m3516, Sigma) or a 15 µ-Slide eight well (80826, Ibidi) and covered with 300 µl of anti-evaporation oil (50051, Ibidi). The oil was necessary to allow oxygen exchange and viability of the sample for long-term imaging. For the experiments of droplet confinement (Fig. 4j), 10 µl of the reaction with morpholinos was added droplet by droplet in a tube with 0.5 ml mineral oil. The tube was flicked three times to break the droplets into smaller droplets. The reaction droplets in oil were then transferred to a coverslip with a spacer (GBL654004, Grace Bio-Labs) and a second coverslip was used to seal the top. During this process, some air droplets formed in the oil, allowing for oxygen exchange. A well with a different coating that allows for imaging at low magnification with higher resolution was used for Supplementary Videos 4 and 10 in the MCAK case (80800, Ibidi). Imaging was performed with a spinning disk confocal microscope (IX83 Olympus microscope with a CSU-W1 Yokogawa disk) connected with two Hamanatsu ORCA-Fusion BT Digital CMOS camera (SD1). Z-stacks were acquired with a stage-top Z piezo and 10–20-µmz-spacing.
FRAP, EB1 and speckle imaging in extract
Of cytoplasmic extract, 25 µl was supplemented with 1 µl of sperm (3,000 sperm per microlitre), 0.6 µM of pig tubulin labelled with 647 Alexa fluorophore and 0.16 µM EB1–mApple22 to image the plus ends of the microtubules. The sample was imaged with SD1 and Olympus ×40 Air (0.65 NA) objective, and extract supplemented with beads was imaged with Olympus ×100 (1.35 NA) silicon oil. Every 2 min, we sequentially acquired five images of EB1 comets 3 s apart followed by one image of tubulin, following existing protocols14. This choice for the framerate allowed us to minimize bleaching of EB1 and follow the EB1 tracks over time. These reactions were also used for FRAP experiments in the case of extract supplemented with purified centrosomes. The FRAP experiments were performed with SDType1 equipped with a photoactivation module, an Olympus ×40 Air (0.65 NA) objective and a 405-nm laser. For speckle imaging, cycling extract was supplemented with 10 nM of Atto 567-labelled tubulin. The extract was encapsulated between two coverslips separated by a spacer (GBL654004, Grace Bio-Labs) to lower the background noise and prevent aster movement. Because the encapsulation restricts oxygen exchange, the reaction was imaged for 15 min. The speckles were imaged with SDType1 and an Olympus ×60 (1.3 NA) silicon oil objective with low laser intensity and at least 2-s exposure time.
... continue reading