Plasmids
To visualize co-translational interactions, plasmids encoding human β-actin, a 3×Flag tag, and 24 MS2 stem-loop repeats were constructed. The β-actin-24×MS2 (MBSV5) sequence54 (Addgene #102718) was amplified and subcloned into pRetroQ-AcGFP-C1 (TaKaRa) via PCR amplification, replacing AcGFP1. Additionally, truncated versions, containing the first 20, 101, 168, 305 and 368 amino acids of β-actin, were generated by amplifying the respective fragment lengths and introducing a stop codon. The plasmid pUbC-NLS-ha-stdMCP-stdGFP55, which expresses the MS2 coat protein fused to GFP (MCP–GFP), was used without modification (Addgene #98916). For imaging post-translational interactions, plasmids encoding β-actin, a 10×SunTag, a 3×Flag tag, and Xbp1u+ were designed. A synthetic β-actin gene (Uniprot P60709) was ordered from Integrated DNA Technologies (IDT) and cloned into pHRdSV40-K560-24×GCN4_v444 (Addgene #72229) by replacing the kinesin-1 motor domain via PCR amplification. The 24×SunTag repeats were then reduced to 10, and the Xbp1u+ sequence45 was introduced using PCR. To generate a plasmid encoding β-actin with the G150P point mutation fused to 10×SunTag, 3×Flag tag and Xbp1u+ the Q5 Site-Directed Mutagenesis Kit (NEB) was used according to the manufacturer’s instructions. To estimate non-specific interaction of chaperone and SunTag alone, a plasmid encoding the 10×SunTag, 3×Flag tag and XBP1u+ sequence without β-actin was constructed by PCR amplification to excise the β-actin gene from the previously generated plasmid. The plasmid pHR-scFv-GCN4-sfGFP-GB1-NLS-dWPRE, which expresses an scFv against the SunTag epitope fused to sfGFP (scFv-sfGFP), was used without modification44 (Addgene #60906). To estimate the distance between mRNA and translating polypeptides, 24×MoonTag56 epitope was placed at the N-terminal end of β-actin-24×MS2 plasmid. Plasmids encoding MoonTag specific nanobody 2H10 were generously provided by M. Tanenbaum. To estimate coincidental collisions with TRiC, we analysed interactions between TRiC and the 500-kDa VCP (P97) complex, which has diffusion properties similar to PFD (Extended Data Fig. 6l). A plasmid encoding VCP with C-terminal HaloTag was provided by Z. Liu.
A plasmid expressing CCT4 with SNAP-tag was generated by inserting SNAP-tag in a loop region between S202 and V203, obtained from Integrated DNA Technologies and cloned into pCW57.1-MAT2A (Addgene #100521).
Cell lines
Human U-2 OS cells (ATCC, HTB-96) were grown in complete media with DMEM containing 4.5 g l−1 D-glucose (Gibco), 10% fetal bovine serum (Gibco), 1% penicillin/streptomycin (Gibco) and 1% non-essential amino acids (Gibco) at 37 °C and 5% CO 2 . Cells were either transfected with Lipofectamine 3000 (Thermo Fisher) or electroporated (Neon transfection system, Invitrogen) following the manufacturer’s instructions. Cells were regularly tested for mycoplasma contamination and no contamination was detected.
The monoclonal U-2 OS cell line expressing CCT4–HaloTag was generated using CRISPR–Cas9-mediated gene integration. A CCT4 specific single guide RNA (sgRNA) (ATCTCTAAGATCTACACTGG) was cloned into the pSpCas9(BB)-2A-Puro (PX459) vector, which encodes SpCas9 and puromycin resistance57 (Addgene #48139). U-2 OS cells were transfected with the Cas9–sgRNA vector and a donor encoding HaloTag using Lipofectamine 3000 following the manufacturer’s instructions. Forty-eight hours after transfection, cells were selected with 1.5 µg ml−1 puromycin (Gibco). Surviving cells were further labelled with a fluorescent HaloTag ligand (Promega) and sorted via fluorescence-activated cell sorting to obtain single clones. The same strategy was applied to generate PFD4–Halo and PFD4–SNAP stable cell lines using PFD4 specific sgRNA (TTCAGTTGTATGCAAAATTC).
The polyclonal U-2 OS cell line expressing RPL10A–SNAP-tag was generated using lentivirus transduction. Lentiviruses were produced and transfected as described58. Forty-eight hours after transfection, cells were selected with puromycin (Gibco) and sorted with a fluorescent SNAP-tag ligand (NEB).
The PFD3 knockdown stable cell line was generated using a PFD3 specific sgRNA (TAAAGTGTGTCTGTGGTTGG) using CRISPR–Cas9-mediated gene deletion. U-2 OS cells were transfected with the Cas9–sgRNA vector using Lipofectamine 3000 and selected with puromycin after 48 h transfection. Cells were further sorted to isolate single clones.
Biochemical assays
SDS–PAGE and immunoblotting
... continue reading