Mouse studies
All mouse experiments were performed according to UK Home Office regulations (project licence 70/8646 and PP3908577) following approval by the University of Glasgow Animal Welfare and Ethical Review Body. Mice were housed in a mixture of indvidually ventilated cages and conventional cages in a facility that operates as a specific-pathogen-free facility at constant temperature (19–23 °C) and humidity (55 ± 10%) under a 12-h light–dark cycle with ad libitum access to standard rodent chow and water; bedding material and tunnels were also included in all cages. All mice were genotyped from ear punch biopsies at weaning by a commercial vendor (Transnetyx). To study tumorigenesis in ageing cohorts, mice were monitored daily. Humane end points were determined based on loss of weight and body condition and the appearance of abdominal swelling. Liver cancer end point was generally identified by significant abdominal swelling or progressive weight loss; tumour volume measurements were not used to determine end point. The censoring criteria for ageing liver cancer cohorts: liver tumour-free mice were censored either due to health reasons not related to liver tumours (for example, epidermal wounds and age-associated lymphoma) or when they had passed 500 days post-induction. For genetically engineered mouse models, animals were assigned to groups according to their genotype. Treatment groups were randomly assigned; however, steps were taken during group assignment to avoid separating males in to singly housed cages. Selection of groups also aimed to maintain an equal sex balance. Investigators were blinded during treatment regimens and at sample collection for timepoint experiments. For ageing experiments, it was not possible for investigators to be blind to genotype as this factor needed to be known to maintain the welfare of the experimental cohort. Group sizes were determined on historical experiments where effect size and power were sufficient to detect statical differences.
The genotypes, transgenes and alleles used for this study were as follows: Lgr5CreER (ref. 39), Gls2CreER (ref.13), GlulCreER (ref. 13), Cyp1a2CreER (ref. 13), Igfbp2CreER (ref. 40), R26CreER (ref. 41), VillinCreER (ref. 42), Ctnnb1ex3 (ref. 43), Apcfl/fl (ref. 9), Apcfl/fl-hypomorphic31, Rnf43fl/fl;Znrf3fl/fl (ref. 44), R26LSL-Myc (ref. 45), R26LSL-tdTomato (ref. 46), BrafV600E (refs. 47,48), Ptenfl/fl (ref. 49), Yapfl/fl (obtained from the International Mouse Phenotyping Consortium Knockout Mouse Project Repository) and Tazfl/fl (ref. 50).
The Igfbp2-knockout mouse line was generated at the CRUK Scotland Institute by CRISPR gene-editing technology. A CRISPR project was designed to the Igfpb2 gene (ENSMUSG00000039323/GRCm39: CM000994.3). Two CRISPR guides were identified, which cut in the intronic sequence surrounding exon 2 (ENSMUSE00001244511) and were demonstrated to have high cutting efficiency in vitro: TAACTCTGTAGGTGGTAACG, TACTAGCCGCTTGGTGTTGA. Alt-R CRISPR–Cas9 crRNA, Alt-R CRISPR–Cas9 tracrRNA and Alt-R spCas9 nuclease were purchased from Integrated DNA Technologies. To generate the electroporation solution, the crRNA–tracrRNA duplex and spCas9 protein were combined in Optimem (Thermo Fisher Life Technologies). Approximately 7 h after in vitro fertilization, the one-cell stage embryos of 5–6-week-old C57BL/6J mice (Charles River) were introduced into electroporation solution and electroporated using a NEPA21 electroporator (Nepa Gene). The following day, two-cell embryos were transferred into the oviducts of pseudopregnant CD1 females (Charles River). Genotyping of subsequent pups was performed from ear samples by PCR using the primers F: AGACTGGGATGTGGAAGCAG and R: ACTTCTCAGTTCTCCAGGGC followed by Sanger sequencing.
Mice were maintained on a mixed C57BL/6 background. Genetic recombination was induced in both male and female mice, 2–4 months of age, with either an adeno-associated virus expressing Cre under the control of the TBG promoter (AAV8.TBG.Cre; AAV.TBG.PI.Cre.rBG was a gift from J. M. Wilson (Addgene plasmid #107787) to achieve temporal-specific and hepatocyte-specific Cre-mediated recombination of floxed alleles, or tamoxifen to activate Rosa26CreER (whole body), VillinCreER (intestinal specific) Lgr5CreER, GlulCreER, Cyp1a2CreER, Igfbp2CreER and Gls2CreER (only male mice were used for the Gls2CreER experiments as female mice did not recombine as efficiently as male mice when treated with tamoxifen). AAV8.TBG.Cre was administered via intravenous (i.v.) tail-vein injections at a volume of 100 μl and a concentration of either 6.4 × 108 GC ml−1 (ref. 51) or 2 × 1011 GC ml−1. Samples were excluded if there was evidence of a failed injection and impaired genetic recombination. At 6.4 × 108 GC ml−1, the AAV8.TBG.Cre tropism is different between sexes; therefore, these experiments were performed on male mice. An exception to this was in the treatment of BrafV600E/+;Rnf43fl/fl;Znrf3fl/fl mice with dabrafenib and LGK974; here, equal numbers of male and female mice were used per experimental group. Tamoxifen (T5648, Sigma-Aldrich) was administered via intraperitoneal (i.p.) injection at 3-mg, 2-mg or 0.5-mg doses.
The PORCN-O-acyltransferase inhibitor LGK974 (205851, MedKoo Biosciences) was administered twice daily via oral gavage at 5 mg kg−1 in a vehicle composed of 0.5% Tween-80 and 0.5% methylcellulose. Rapamycin (R-5000, LC Laboratories) was administered once daily via i.p. injection at 10 mg kg−1 in a vehicle composed of 5% ethanol, 5% polyethylene glycol 400 and 5% Tween-80 in PBS. The BRAF inhibitor dabrafenib (A-1219, Active Biochem) was administered once daily via oral gavage at 30 mg kg−1 in a vehicle composed of 0.5% hydroxypropyl methylcellulose and 0.1% Tween-80. To assay cell proliferation, the nucleotide analogue BrdU (RPN201, Amersham Biosciences) was administered 2 h before sampling via i.p. injection of 250 μl.
The AAV8.U6.shRNA-mIgfbp2, AAV8.CMV.Igfbp2 and AAV8.TBG.myrAkt were designed and constructed by a commercial vendor VectorBuilder. For the AAV8.U6.shRNA-mIgfbp2, the shRNA targeted the following sequence in the 3′ untranslated region (UTR) of the mouse Igfbp2 gene GAACCTCCCTTGCTTCTGTTA (catalogue number: P230413-1010twp; lot number: 230420AAVN02). Knockdown was confirmed using IGFBP2 IHC on livers treated with AAV8.U6.shRNA-mIgfbp2. The corresponding control AAV8.U6.shRNA-scramble was also purchased from VectorBuilder (catalogue number: AAV8LP(VB010000-0023jze)-C; lot number: 220329AAVJ07). Both AAV.U6.shRNAs were administered via i.v. tail-vein injections at 2 × 1011 GC ml−1. For the AAV8.CMV.Igfbp2 virus, the gene encoding mouse IGFBP2 was packaged in to an AAV8.CMV vector (catalogue number: scAAV8MP(VB241111-1375dkc); lot number: 241122AAVS06). IGFBP2 expression was confirmed using IGFBP2 IHC on livers treated with AAV8.CMV.Igfbp2. For the AAV8.TBG.myrAkt virus, mouse AKT1 with a Src myristoylation sequence at the beginning52 was packaged in to an AAV8.TBG vector (catalogue number: AAV8L(VB250225-1147vdk); lot number: 250311AAVG01). For the AAV8.CMV.Igfbp2 and AAV8.TBG.myrAkt experiments, two control AAV8.CMV.eGFP and AAV8.TBG.eGFP viruses were used (catalogue number: scAAV8CP(VB010000-9304aud)-f and AAV8C(VB010000-9287ffw)-b; lot number: 241114AAVP24 and 241012AAVA01).
Human tumour data
TCGA-LIHC data were downloaded from cBioPortal (https://cbioportal-datahub.s3.amazonaws.com/lihc_tcga_pan_can_atlas_2018.tar.gz). For Extended Data Fig. 10, three additional cohorts of HCC were used. The AMC53 and INSERM54 data were both downloaded from cBioPortal (https://cbioportal-datahub.s3.amazonaws.com/lihc_amc_prv.tar.gz and https://cbioportal-datahub.s3.amazonaws.com/hcc_inserm_fr_2015.tar.gz). The LINC-JP data were downloaded from the ICGC data portal (https://dcc.icgc.org/releases/release_28/Projects/LINC-JP). Mismatch-repair deficient tumours were identified with SigMA55 and removed from the analysis. To stratify HCC samples based on CTNNB1 mutation status, only activating mutations were considered. Activating mutations were defined as missense mutations at hotspots (protein position 32, 33, 34, 35, 36, 37, 41, 45, 335, 383 and 387) and in-frame indels at hotspots (protein position 23–71) according to Chang et al.56. Expression data were obtained from the batch-normalized RSEM (RNA-seq by Expectation-Maximization) values from TCGA-LIHC after log 2 transformation with a pseudo-count of 1.
Human tumour data: GSVA analysis
... continue reading