Health monitoring and sampling
TNP is the largest remaining primary rainforest in Western Africa. Its wild populations of NHP have been studied by the TCP since 1979 (ref. 34). TCP established a veterinary programme from 2001 onwards13. This veterinary programme conducts wildlife mortality surveillance and health monitoring of the four neighbouring groups of chimpanzees and one group of sooty mangabeys that are habituated to human observers. The mangabey group (named the Audrenisrou group) was habituated in November 2012 (ref. 35), and at the time of the outbreak consisted of about 80 individuals. The habituated groups are followed daily by trained field assistants and research staff. Names are given to each habituated individual. Newborns are given a temporary name indicating that they are the infant (BB) of a certain individual (for example, BB-Atacama indicates the newborn of Atacama). Behavioural data, as well as faecal and urine samples, are routinely collected from all the adults of the group. Faecal samples are collected with a plastic spatula right after defecation occurs and stored in 2-ml cryotubes. Urine is collected with fine Pasteur pipettes from underlying vegetation as soon as the animals urinate from a higher position, and is stored in 2-ml cryotubes. These samples are preserved in liquid nitrogen in the field, transported to Germany in dry ice and then stored at −80 °C until further analysis. When clinical signs are observed in the groups, observations and sampling are intensified. During this MPXV outbreak faecal samples were collected in both dry 2-ml cryotubes and in cryotubes containing nucleic acid preserving (NAP) buffer from most individuals of the group belonging to all age categories (infants, juveniles, subadults and adults), and from both symptomatic and asymptomatic individuals. Faecal samples are difficult to collect from infants, therefore the number of these samples is lower than other age classes. It is also important to note that in 2022 a substantial number of male juveniles immigrated to the Audrenisrou group, and many births occurred, leading to an increase in the total population to 80 individuals. To obtain an overview of viral DNA shedding in the mangabey group, we tested faecal samples from three key time periods: from 4 months before the first observations of clinical signs (1 October 2022 to 26 January 2023), during the outbreak (27 January 2023 to 26 April 2023) and up to 4 months after the last symptoms were observed (27 April 2023 to 24 August 2023). A total of 444 faecal samples were tested for MPXV, including those from just before (n = 114), during (n = 170) and after (n = 89) the mpox outbreak in the mangabey group. Details are provided in Supplementary Table 2. The veterinary team of TCP also performs necropsies on all animals found dead in the research area. Necropsies are done by trained veterinarians wearing full personal protective equipment. All used materials are incinerated or disinfected with 1% sodium hypochlorite solution and the carcasses are buried, according to the WHO guidelines. Samples are collected from all inner organs when carcass decomposition is not too advanced and stored in 2-ml cryotubes, both empty and filled with NAP buffer. The cryotubes are then preserved in liquid nitrogen in the field, transported to Germany in dry ice and stored at −80 °C until further analysis. In this study, we included 88 necropsy samples from 23 carcasses representing 11 species (and 4 species for which taxonomic assignment was not possible) collected between 2019 and 2024. Further details are provided in Supplementary Tables 1 and 5.
Trapping of small terrestrial mammals inside and around TNP
Rodents and shrews were trapped using Sherman, Havahart-style or 0.5-m cage traps and were anaesthetized using a combination of ketamine (mouse dose 50 mg kg−1, rats dose 35 mg kg−1; Medistar) and xylazine (mouse dose 5 mg kg−1, rat dose 3.5 mg kg−1; WDT) intramuscularly. After being anaesthetized, the animals were measured, weighed and sampled. After sampling, the animals were marked and placed in an individual box until full recovery was observed. Anaesthetized animals were monitored closely and in some cases antisedan (5 mg kg−1; Vetoquinol) was administered intramuscularly to facilitate recovery. Saline solution was sometimes applied as a subcutaneous infusion to prevent dehydration and applied on the eyes to prevent from drying. After recovery, the animals were released where they were caught. From July to November 2021 and March to April 2023, 173 rodents were trapped in the territory of the mangabey group. From these two field missions, we collected 167 oral swabs, 167 rectal swabs, 23 nasal swabs, 133 faecal samples and 39 samples from skin lesions. Eight individuals died in the trap or succumbed to anaesthetization, and one was euthanized because of signs of extreme weakness. In these cases, necropsies were performed and samples were collected from all main organs. All samples were stored in 2-ml cryotubes dry or with NAP buffer, frozen in liquid nitrogen in the field, transported in dry ice to Germany and then kept at −80 °C. From these trapping missions, a total of 553 samples, including different tissues and swabs were tested for OPVs. We also made use of samples originating from a broader initiative aimed at characterizing the biodiversity of small mammals and related pathogens along a gradient spanning from three villages bordering TNP on the west to the pristine forest in the immediate vicinity of the sooty mangabey territory. We set traps along three parallel transects of about 9 km covering distinct environments: (1) anthropic/domestic (inside houses), (2) at the village periphery, (3) at the edge between cultivated fields and the national park and (4) in the pristine forest of the national park. Sampling was performed from July to September 2021 and April to May 2022. In total, 521 rodents and shrews were trapped and sampled (as mentioned above), of which 82 were euthanised and underwent a full necropsy. Oral and rectal swabs were stored in 2-ml tubes with NAP buffer at room temperature until transport to Abidjan where they were stored at −20 °C. Necropsy samples were stored in 2-ml cryotubes and immediately frozen in liquid nitrogen. Samples were transported to Germany on dry ice and then stored at −80 °C (necropsies) or −20 °C (swabs in NAP buffer). From this sample set, we tested 506 oral swabs, 269 rectal swabs and different organs from the 82 necropsies. In toto, 1,011 samples from different tissues and swabs were tested for OPV. Details for the sampled animals are provided in Supplementary Table 4a,b.
DNA extraction and OPV DNA detection
Nucleic acids were extracted from 40 mg of faecal matter using the GeneMATRIX Stool DNA Purification Kit (Roboklon). For the necropsy samples, 20 mg of tissue were used for DNA extraction with the DNeasy Blood and Tissue kit (Qiagen) or QIAamp Viral RNA Mini Kit (Qiagen). Nucleic acids from virus isolates were extracted using the NucleoMag VET Kit (Macherey-Nagel) and with the RNAdvance Tissue Kit (Beckman Coulter). DNA extracted from faecal and necropsy samples (excluding rodents) was tested for MPXV in duplicate using a TaqMan real-time quantitative PCR (qPCR) targeting the G2R locus36. Each PCR reaction had a total volume of 25 µl and included the following components: 5 µl of DNA template, 11.8 µl of nuclease-free water, 2.5 µl of 10× reaction buffer, 2 µl of 50 mM MgCl 2 , 1 µl of 2.5 mM dUTPs, 1 µl of 10 µM G2R G forward primer (5′-GGAAAATGTAAAGACAACGAATACAG-3′), 1 µl of 10 µM G2R G reverse primer (5′-GCTATCACATAATCTGGAAGCGTA-3′), 0.5 µl of 10 µM G2R G probe (AAGCCGTAATCTATGTTGTCTATCGTGTCC) and 0.2 µl of Platinum Taq polymerase. PCR cycling conditions consisted of an initial denaturation at 95 °C for 6 min, followed by 45 cycles of 95 °C for 5 s and 60 °C for 30 s. Rodent DNA extracts (including the DNA extracts from trapped rodents and necropsies) were tested in duplicate for OPV using a TaqMan real-time PCR targeting the P4A gene37. Each reaction was prepared in a total volume of 25 µl, consisting of 5 µl of DNA template, 12.7 µl of nuclease-free water, 2.5 µl of 10× reaction buffer, 2 µl of 50 mM MgCl 2 , 1 µl of 2.5 mM dUTPs, 0.75 µl of 10 µM OPV forward primer (TAATACTTCGATTgCTCATCCAGG), 0.75 µl of 10 µM OPV reverse primer (ACTTCTCACAAATGGATTTGAAAATC), 0.1 µl of 10 µM OPV TMgB probe (6FAM-TCCTTTACGTG+A + T + A + A + A + T + C + A + T) and 0.2 µl of Platinum Taq polymerase. PCR cycling conditions were set to an initial denaturation at 95 °C for 10 min and 45 cycles of 95 °C for 15 s and 60 °C for 34 s. Positive extracts were then tested with the MPXV-specific qPCR mentioned above. A confirmatory PCR targeting a 270 base pair (bp) fragment of the haemagglutinin (HA) gene of OPVs38 was performed for all the extracts that had weakly positive results in the MPXV or OPV qPCRs. For this assay, a single reaction had a total volume of 25 µl, containing 5 µl of DNA template, 11.8 µl of nuclease-free water, 2.5 µl of 10× reaction buffer, 2 µl of 50 mM MgCl 2 , 2 µl of 2.5 mM dUTPs, 0.75 µl of 10 µM OPV.HA-156 forward primer (GGAGCCCAATTCCATTATTC), 0.75 µl of 10 µM OPV.HA-424 reverse primer (gTATTATgTCTATAgTCgATTCACTATCTg) and 0.2 µl of Platinum Taq polymerase. The PCR protocol included an initial denaturation at 95 °C for 5 min, followed by 45 cycles of 95 °C for 15 s, 60 °C for 30 s and 72 °C for 60 s, with a final extension at 72 °C for 7 min and a hold at 4 °C. The PCR products were then visualized by electrophoresis on a 2% agarose gel.
Mammal species identification
For molecular species identification, two PCR systems targeting the mitochondrial genome were used. The first system designed by Geller and colleagues39 targets the CO1 gene. Each reaction contained 2.5 µl of DNA template, 14.8 µl of nuclease-free water, 2.5 µl of 10× reaction buffer, 1 µl of 50 mM MgCl 2 , 1 µl of 2.5 mM dUTPs, 1 µl of BSA (1 mg ml−1), 1 µl of 10 µM forward primer jgLCO1490 (5′-TITCIACIAAYCAYAARGAYATTGG-3′), 1 µl of 10 µM reverse primer jgHCO2198 (5′-TAIACYTCIGGRTGICCRAARAAYCA-3′) and 0.2 µl of Platinum Taq polymerase. The PCR protocol included an initial denaturation at 94 °C for 2 min, followed by 47 cycles of 95 °C for 30 s, 52 °C for 30 s and 72 °C for 50 s, with a final extension at 72 °C for 2 min and a hold at 8 °C. The PCR products were then visualized by electrophoresis on a 1.5% agarose gel. The second system targets the cytB gene40. Each reaction contained 1 µl of DNA template, 16.25 µl of nuclease-free water, 2.5 µl of 10× reaction buffer, 2 µl of 50 mM MgCl 2 , 2 µl of 2.5 mM dUTPs, 0.5 µl of 10 µM forward primer CytB-outF (5′-CGAAGCTTGATATGAAAAACCATCGTTG-3′), 0.5 µl of 10 µM reverse primer CytB-inR (5′-AGTGGRTTRGCTGGTGTRTARTTGTC-3′) and 0.25 µl of Platinum Taq polymerase. The PCR protocol included an initial denaturation at 95 °C for 5 min, followed by 40 cycles of 95 °C for 30 s, 52 °C for 30 s and 72 °C for 45 s, with a final extension at 72 °C for 10 min and a hold at 8 °C. The PCR products were then visualized by electrophoresis on a 1.5% agarose gel. If a band was visible at the target lengths of the PCRs, the PCR product was Sanger sequenced. After removal of the primer target-regions in Geneious Prime 2025.1.2 (https://www.geneious.com), a query search of the resulting reads to identify the best sequence matches was performed on Nucleotide BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi). If molecular identification of species failed, the animals were determined morphologically following Kingdon Field Guide to African Mammals41 and Mammals of Africa (Vol. III)33.
Virus isolation
Virus isolation was attempted from 13 faecal samples (12 from the mangabeys, 1 from the fire-footed rope squirrel), 13 tissue samples and maggots from two necropsies. Skin, lung and spleen were tested for each mangabey necropsy, as well as a maggot from one individual. The squirrel samples tested encompassed skin, lung, spleen, liver, faeces and maggots. The samples were added to cell culture medium with 10% fetal bovine serum supplemented with penicillin/streptomycin (Gibco) and gentamicin/amphotericin (Gibco), bead homogenized on a bead ruptor and incubated overnight at 8 °C. Sample homogenate was filtered through a 0.8-µm pore membrane to remove larger particles and potential contaminating bacteria. The filtrate was added to confluent layers of MA-104 cells and cultivated with the aforementioned antibiotic-supplemented medium in 12.5-cm2 rectangular canted neck cell culture flasks. MA-104 cells originated from the Collection of Cell Lines in Veterinary Medicine, Insel Riems. The cell line has been authenticated by DNA barcoding of the cytochrome b gene, species-specific PCR, PCR targeting the aldolase gene and restriction fragment length polymorphism analysis. The cell line used in this study was not tested for mycoplasma contamination. Cell cultures were passaged after 3 days. If a cytopathic effect was visible, cells were passaged further to increase the viral titre for shotgun sequencing.
... continue reading