GoKawiilAnimals
Animal procedures were conducted under a protocol approved by the Institutional Animal Care and Use Committee of Icahn School of Medicine at Mount Sinai (IPROTO202200000184). All of the mice were maintained on the C57BL/6J genetic background for at least three generations. Animals were housed in a specific-pathogen-free barrier facility under a 12 h–12 h light–dark cycle with ad libitum access to food and water. Ambient temperature was maintained at approximately 18–23 °C with relative humidity of 40–60%. Mice were group-housed (up to five per cage) in corn bedding-lined cages with standard pellet chow and water bottles and were acclimatized to the facility for at least 2 weeks before experimentation. All of the mice used in the study were young adults (aged <30 weeks), unless otherwise indicated.
Mouse strains were obtained from The Jackson Laboratory: C57BL/6J (JAX, 000664); Tg(Thy1-cre/ERT2-eYFP)HGfng (JAX, 012708, known as SLICK-H)54,55; B6.Cg-Tg(Nes-cre)1Kln/J (JAX, 003771, known as Nescre)56; Ahrtm3.1Bra/J (JAX, 006203, known as Ahrfl)57; and B6;129-Gt(ROSA)26Sortm5(CAG-Sun1/sfGFP)Nat/J (JAX, 021039, known as INTACT)58; and Arntfl/fl mice59 were provided by F. Gonzalez.
The following primers were used for genotyping by PCR using mouse tail DNA: Ahrfl/fl mice: F1: GTCACTCAGCATTACACTTTCTA, F2: CAGTGGGAATAAGGCAAGAGTGA, R1: GGTACAAGTGCACATGCCTGC. Expected band sizes: 106 bp for wild-type allele, 140 bp for the floxed allele and 180 bp for the excised floxed allele. Arntfl/fl mice: F1: TGCCAACATGTGCCACCATGT, R1: GTGAGGCAGATTTCTTCCATGCTC. 290 bp for the wild-type allele, 340 bp for the Arnt floxed allele. Nescre mice: F1: CCGCTTCCGCTGGGTCACTGT, R1: TGAGCAGCTGGTTCTGCTCCT, R2: ACCGGCAAACGGACAGAAGCA. 379 bp for the wild-type allele, 229 bp for the transgenic cre allele. Rosa26INTACT mice: F1: GCACTTGCTCTCCCAAAGTC, R1: CATAGTCTAACTCGCGACACTG, R2: GTTATGTAACGCGGAACTCC. 557 bp for wild-type allele, 300 bp for the knock-in allele. Thy1-creERT2 mice: F1: TCTGAGTGGCAAAGGACCTTAGG, R1: CGCTGAACTTGTGGCCGTTTACG, Int-F2: CAAATGTTGCTTGTCTGGTG, Int-R2: GTCAGTCGAGTGCACAGTTT. 200 bp for the wild-type allele, 300 bp for the transgenic cre allele.
Pharmacological treatments
To induce CreER-mediated cKOs, tamoxifen (Sigma-Aldrich, T5648) in corn oil (Sigma-Aldrich, C8267) was injected into adult mice i.p. (100 mg per kg) once daily for 5 days.
AhR agonists
2-(1′H-indole-3′-carbonyl)-thiazole-4-carboxylic acid methyl ester (ITE; Tocris 1803), l-Kyn (Tocris 4393), 6-formylindolo[3,2-b]carbazole (FICZ; Tocris 5304) and norisoboldine (NOR; Selleckchem S9092) were reconstituted in DMSO. For in vitro studies, the applied concentrations are indicated in the main text. For in vivo experiments, ITE was diluted in 12.5% kolliphor/PBS (Sigma-Aldrich, C5135) to a final volume of 600 µl and injected i.p. at 10 mg per kg.
AhR antagonists
CH (Tocris, 3858), 6,2′,4′-trimethoxyflavone (TMF; Tocris, 3859), StemRegenin-1 (SR1; Selleckchem, S2858) and BAY (Selleckchem, S8995) were reconstituted in DMSO. For in vivo studies, TMF was further diluted in 12.5% kolliphor/PBS, and injected i.p. at 10 mg per kg (or, for SR1 and BAY60, 25 mg per kg) using a Hamilton fine syringe (Hamilton, 80920).
... continue reading