Phylogenetic analysis
The amino acid sequence of GeCas12a2 was aligned with other Cas12a2 nuclease sequences15,59 using Clustal Omega60. The alignment was trimmed with ClipKIT61 and used to reconstruct a phylogeny with IQ-TREE v2.0.3 (-m MFP -T 8 -B 1000)62, using a maximum-likelihood approach. The phylogeny included Cas12a orthologues and used Cas12c as an outgroup. Branch confidence was reported as ultrafast bootstrap values (ranging from 0 to 100).
PFS library preparation
A PFS-containing plasmid library (CBS-6873) was constructed to include a target sequence (Supplementary Tables 8 and 9) followed by five randomized nucleotides (NNNNN). The target sequence was placed under a PJ23119 promoter and cloned into a low-copy sc101 origin plasmid (about five copies per cell). The library was generated by amplifying a target-encoding plasmid with primers ODpr23 and ODpr24 (Supplementary Tables 9 and 10). The forward primer contained a 5-nt randomized overhang. The PCR product was treated with DpnI to remove template DNA, ligated, and electroporated into Escherichia coli (E. coli) TOP10, yielding over two million transformants (approximately 2,000-fold library coverage).
PFS library depletion
The PFS preference of the GeCas12a2 nuclease (CBS-6874) was assessed by targeting the CBS-6873 PFS plasmid library with a CAO1-targeting CRISPR RNA (crRNA) plasmid (CBS-6875) or a non-targeting crRNA plasmid (CBS-6876). The GeCas12a2 nucleotide sequence was codon-optimized for expression in E. coli. The nuclease-encoding sequence was under a T7 promoter, whereas crRNA was expressed from PJ23119. Escherichia coli BL21(AI) cells containing nuclease and crRNA plasmids were electroporated with the PFS plasmid library. Each electroporation used approximately 500 ng of library plasmid DNA in 50 µl competent cells, followed by recovery in lysogeny broth medium containing 0.1 mM isopropyl β-d-1-thiogalactopyranoside (IPTG) and 0.2% l-arabinose. Overnight cultures (of approximately two million transformants) ensured greater-than-2,000-fold library coverage. Plasmids were purified with ZymoPURE II Plasmid Midiprep Kit (D4201).
PFS library sequencing and analysis
Purified plasmids from targeting and non-targeting conditions were PCR-amplified using primers ODpr55 and ODpr56 (Supplementary Table 10) with KAPA HIFI HotStart polymerase (KK2601) for 20 cycles at 64.5 °C, following the manufacturer’s protocol. Indexed PCR products were sequenced on Illumina NovaSeq 6000 (paired-end, 150 bp reads), at least two million reads each. Raw FASTQ files were processed with Trimmomatic v.0.39 (parameters: ILLUMINACLIP:TruSeq3-PE.fa:2:30:10, LEADING:3, TRAILING:3, SLIDINGWINDOW:4:15). Paired-end reads were merged with BBMerge (qtrim = t trimq = 10 minlength = 20). Sequences containing motifs matching TTCCTTCAGGTGTTGCTCCA (…..)GGTGAGTTCT were extracted, excluding sequences with N bases or Phred scores of below 20. Depletion scores were calculated using the following formula: depletion = sum(non-target)/sum(target) × count(target)/count(non-target). log 2 fold-change values for depletion scores were computed for nucleotides at PFS positions (−1 to −5). Scatterplots visualizing PFS preferences were generated using Matplotlib in Python.
Coexpression of gRNA and FLAG-tagged GeCas12a2 or FLAG-tagged FnCas12a
Electrocompetent E. coli BW25113 cells were transformed with a GeCas12a2-FLAG expression plasmid and a plasmid containing the gRNA’s sequence (Supplementary Table 9). Newly transformed cells were grown on lysogeny broth agar plates containing 25 µg ml–1 kanamycin (Kan) and 100 µg ml–1 ampicillin (Amp) for 12–16 h at 37 °C. A single colony was selected and used to start an overnight culture, from which a 120 ml culture of lysogeny broth–Amp–Kan medium was inoculated to a starting OD 600 of 0.05, and then incubated at 37 °C at 200 r.p.m. When OD 600 = 0.2 was reached, the cultivation temperature was lowered from 37 °C to 21 °C. Once the growth reached an OD 600 of 0.5, expression was induced by adding L-arabinose (to a final concentration of 0.2%). Cells were collected by centrifugation after 16–18 h at 21 °C.
... continue reading