GoKawiilCells and culture conditions
Ovcar8, JHOS4, Uwb1.289 and PEO1 cells were a gift from Benjamin Bitler (University of Colorado). Ovcar8 cells were cultured in RPMI 1640 medium (Gibco, 11875119) supplemented with 5% fetal bovine serum (FBS; BioWest, S1620) and 1% penicillin–streptomycin (Fischer Scientific, 15-140-122). JHOS4 cells were cultured in a 1:1 mixture of Dulbecco’s Modified Eagle Medium (DMEM) (Gibco, 11965092) and Ham’s F-12 (DMEM/HamF12) supplemented with 10% FBS (BioWest, S1620), 0.1 mM non-essential amino acids (Gibco, 11140050) and 1% penicillin–streptomycin (Fischer Scientific, 15-140-122). Uwb1.289 cells were cultured in a 1:1 ratio of RPMI 1640 (Gibco, 11875119) and MEGM (Sigma-Aldrich, C39110) supplemented with 3% FBS (BioWest, S1620) and 1% penicillin–streptomycin (Fischer Scientific, 15-140-122). PEO1 cells were cultured in RPM1-1640 medium (Gibco, 11875119) supplemented with 10% FBS (BioWest, S1620), 2 mM glutamine (Gibco, 25030081), 2 mM pyruvate (Gibco, 11360070) and 1% penicillin–streptomycin (Fischer Scientific, 15-140-122). Ovcar8-empty vector (EV) and Ovcar8-CCNE1 cell lines were created by transduction of a cyclin E1-overexpression plasmid generated by Twist Bioscience (pTwist Lenti SFFV Puro). These cell lines were cultured in RPMI 1640 medium (Gibco, 11875119) supplemented with 5% FBS (BioWest, S1620), 1% penicillin–streptomycin (Fischer Scientific, 15-140-122) and 1 µg ml−1 puromycin (Gibco, A1113802). FT282-EV and FT282-CCNE1 cells were a gift from Ronny Drapkin (University of Pennsylvania). FT282-EV and FT282-MYC cell lines were created by transduction with pCDH-EF1-FHC (Addgene, 64874) or pCDH-Flag-c-Myc (Addgene, 102626), respectively. FT282 cells were cultured in DMEM:F12 supplemented with 2% FBS and 1% penicillin–streptomycin under 2% oxygen conditions (with 1 µg ml−1 puromycin when transduced with Twist plasmids). HepG2 cells were purchased from ATCC and cultured in DMEM (Fischer Scientific, 12-430-054) supplemented with 10% FBS (BioWest, S1620) and 1% penicillin–streptomycin (Fischer Scientific, 15-140-122). The U2OS-mCherry-LacI-Fok1 cell line was a gift from Roger Greenburg (University of Pennsylvania) and was maintained in DMEM (Invitrogen, 11885084) with 10% FBS and 1% penicillin–streptomycin. To induce DSBs, cells were treated with Z-(4)-Hydroxytamoxifen (Millipore Sigma, H7904; 1 μM) and Shield-1 (TaKaRa, 632189; 1 μM) for 4 h in charcoal-stripped FBS containing medium. HEK293FT cells were used for lentiviral packaging and were cultured in DMEM (Corning, 10-013-CV) supplemented with 10% FBS, according to ATCC's instructions. Kuramochi cells were a gift from Ronald Buckanovich (University of Pittsburgh) and cultured in RPMI 1640 medium (Gibco, 11875119) supplemented with 5% FBS (BioWest, S1620) and 1% penicillin–streptomycin (Fischer Scientific, 15-140-122). KPCA.B cells were a gift from Robert Weinberg (Whitehead Institute of Biomedical Research) and cultured in DMEM media (Fischer Scientific, 12-430-054) supplemented with 1% insulin-transferrin-selenium (Thermo Fisher Scientific; ITS-G, 41400045), 100 μl EGF (10 µg ml−1), 4% heat-inactivated FBS (Thermo Fisher Scientific; IFS, F4135) and 1% penicillin–streptomycin (Fischer Scientific, 15-140-122). Cells were cultured in humidified incubators at 37 °C, 5% CO 2 and atmospheric oxygen, except FT282 cells, which were cultured at 2% oxygen. The authenticity of the cell lines was not tested. All cell lines were tested monthly for my coplasma as described42.
Plasmids, antibodies, inhibitors, treatments and metabolites
All shRNAs were obtained from Sigma-Aldrich. The RNAi consortium numbers (TCRN) are as follows: shIDH1 1, TRCN0000027253 (target sequence: GCTTTGGAAGAAGTCTCTATT); shIDH1 2, TRCN0000027249 (target sequence: CCTTTGTATCTGAGCACCAAA); shTMLHE 1, TRCN0000064804 (target sequence: GCACACTGACACTACCTATTT); shTMLHE 2, TRCN0000064807 (target sequence: CGCTTTGATTACGTCTGGCTT); shBRCA1 1, TRCN0000010305 (target sequence: AGAATCCTAGAGATACTGAA); shBRCA1 2, TRCN0000039833 (target sequence: CCCTAAGTTTACTTCTCTAAA); shCROT 1, TRCN0000036009 (target sequence: CGAGAATATCTGATTGGTCTT); shCROT 2, TRCN0000036013 (target sequence: GCCTATCTGGATGTTCGTATA); shCRAT 1, TRCN0000035495 (target sequence: GTCATCGAGTACACGAAGAAA); shCRAT 2, TRCN0000035496 (target sequence: CAAGGCATACAACACCCTCAT); shACLY, TRCN0000078286 (target sequence: GCCTAAGTACTCTTGCCAGTT). The pLKO.1 shGFP control was obtained from Addgene (30323). Wild-type IDH1 with overexpression plasmid 3× HA tag was generated by Twist Bioscience (pTwist Lenti SFFV Puro).
The following antibodies were obtained from the indicated suppliers. Primary antibodies: rabbit anti-IDH1 (8137S, RRID: AB_10950504, WB 1:1000) from Cell Signaling Technology; rabbit anti-TMLHE (16621-1-AP, RRID:AB_2205303, WB 1:1000) from Proteintech; rabbit anti-TMLHE (HPA034589, RRID:AB_10670571, IHC 1:100) from ATLAS; mouse anti-cyclin E1 (4129S, RRID:AB_2071200, clone HE12, WB 1:1000) from Cell Signaling Technology; mouse anti-Cyclin E1 (HPA018169, RRID: AB_1847384, IHC 1:500) from Sigma Aldrich; rabbit anti-MYC (13987, RRID: AB_2631168, clone D3N8F, WB 1:1,000) from Cell Signaling Technology; mouse anti-vinculin (V9131, RRID: AB_477629, clone hVIN-1, WB 1:1,000) from Sigma Aldrich; rabbit pan-acetyl H3 (61638, RRID: AB_2793714, WB 1:1000, IHC 1:1,000) from Active Motif; rabbit Total Histone H3 (05-928, RRID: AB_492621, clone A3S, WB 1:1,000) from Millipore; rabbit pan-acetyl H4 (39925, RRID: AB_2687872, WB 1:1,000, IHC 1:1,000) from Active motif; rabbit Total Histone H4 (13919S, RRID: AB_2798345, clone D2X4V, WB 1:1,000) from Cell Signaling Technology; rabbit H4K8ac (GTX128957, RRID: AB_2885846, WB 1:1,000, IHC 1:1,000) from GeneTex; rabbit H4K12ac (13944S, RRID: AB_2798350, clone D2W60, WB 1:1,000) from Cell Signaling Technology; rabbit H4K23ac (39131, RRID: AB_2793165, WB 1:1,000) from Active Motif; rabbit H3K23ac (PA5-109818, RRID: AB_2855229, IHC 1:50) from Thermo; rabbit pan-acetyl H3 (PA5-114693, RRID: AB_2899329, IHC 1:200) from Thermo; rabbit H4K12ac (ab177793, RRID: AB_2651187, clone EPR17906, IHC 1:1,000) from Abcam; mouse anti-Beta Actin (A1978, RRID: AB_476692, clone AC-15, WB 1:1,000) from Sigma Aldrich; rat anti-BrdU (ab6326, RRID: AB_305426, clone BU1/75 (ICR1), IF 1:500) from Abcam; mouse anti-phospho-Histone H2A.X Ser139 (05-636, RRID: AB_309864, Clone JBW301, IF 1:500) from Millipore Sigma; rabbit anti-53BP1 (A300-272A, RRID: AB_185521, IF 1:500) from Bethyl; mouse BRCA1 (sc-6954, RRID:AB_626761, clone D-9, IF 1:500, WB 1:1,000) from Santa Cruz Biotechnology; rabbit anti-CrOT (13543-1-AP, RRID: AB_2085513, WB 1:1,000) from Proteintech; rabbit anti-CrAT (PAC400Mu01, WB 1:1,000) from Cloud-Clone Corp; rabbit anti-RAD51 (ab133534, RRID:AB_2722613, clone EPR4030(3), IF 1:500) from Abcam; mouse anti-PAR/pADPr (4335-MC-100, RRID:AB_2572318, clone 10HA, IF 1:500) from Biotechne; rabbit anti-ATP-citrate lyase (D1X6P) (ab13390, RRID:AB_2798203, clone D1X6P, WB 1:1,000), rabbit anti-G6PD (HPA000834, RRID: AB_1078977, WB 1:1,000) from Sigma Aldrich; mouse anti-LAMP2 (sc-18822, RRID: 626858, clone H4B4, WB 1:1,000) from Santa Cruz Biotechnology; rabbit anti- UGGT1 (14170-1-AP, RRID: 1288973, WB 1:1,000) from ThermoFisher Scientific; rabbit anti-HSP60 (D6F1) XP (ab12165, RRID:AB_2636980, clone D6F1, WB 1:1;000); normal mouse IgG (2025, RRID: AB_737182, ChIP 2 μg) from SantaCruz Biotechnology; normal rabbit IgG (2729S, RRID: AB_1031062, ChIP 2 μg) from Cell Signaling Technology; Histone H4K8ac (A7258, RRID: AB_2767802, WB 1:1,000) from ABclonal; Biotin (Bethyl, A15-109A, WB 1:1,000). Secondary antibodies: anti-mouse (7076, RRID:AB_330924, WB 1:5,000) and anti-rabbit (7074, RRID: AB_2099233, WB 1:5,000) horseradish peroxidase (HRP)-conjugated secondary antibodies from Cell Signaling Technology. For immunofluorescence, fluorescein donkey anti-rat IgG (712-095-150, RRID: AB_2340651, 1:5,000) from Jackson ImmunoResearch Laboratories; fluorescein donkey anti-mouse IgG (715-095-150, RRID: AB_2340792, 1:5,000) from Jackson ImmunoResearch Laboratories; fluorescein (FITC)-affinity pure donkey anti-rabbit (711-095-152, RRID: AB_2315776, 1:5,000) from Jackson ImmunoResearch Laboratories; Cy3Goat anti-rabbit (111-165-003, RRID: AB_2338000, 1:5,000) from Jackson ImmunoResearch Laboratories; Cy3-affinity pure donkey anti-mouse (715-165-150, RRID:AB_2340813, 1:5,000) from Jackson ImmunoResearch Laboratories.
The inhibitors used in this study are as follows: GSK864 (IDH1 inhibitor, MedChem Express, HY-19540); olaparib (PARP inhibitor, ApexBio, A4154); veliparib (PARP inhibitor, Selleck Chemicals, S1004); niraparib (PARP inhibitor, ChemScene, CS-0780); cisplatin (Selleck Chemicals, S1166); mildronate (carnitine synthesis inhibitor, Selleck Chemicals, S4130); (Z)−4-hydroxytamoxifen (Millipore Sigma, H7904); Shield-1 (TaKaRa, 632189); WM-3835 (HAT inhibitor, Selleck Chemicals, S9805); PARG inhibitor (Tocris, PDD00017273, 5952). The metabolites used in this study are as follows: αKG (dimethyl-2-oxoglutarate, Sigma Aldrich, 340631); triethyl citrate (Sigma Aldrich, 14849); diethyl succinate (Sigma Aldrich, 112402); l-carnitine hydrochloride (Millipore Sigma, C0283); O-acetyl-l-carnitine hydrochloride (Sigma Aldrich, A6706); propionyl-l-carnitine (Cayman Chemical Company, 9001873); butyryl-l-carnitine (Cayman Chemical Company, 26542); N-acetyl-l-cysteine (Sigma Aldrich, A7250); and sodium acetate (Millipore Sigma, 127-09-3).
Metabolite measurement
Metabolites were measured by liquid chromatography–high-resolution mass spectrometry adapted from two previously published approaches for polar metabolites43 and acyl-CoAs44. For polar metabolomics of carnitines and tricarboxylic acid (TCA) cycle metabolites, samples were quenched in 1 ml pre-chilled at −80 °C 80:20 methanol:water (vol/vol) and spiked with 50 µl 1 µM isotope-labelled TCA cycle mix (Cambridge Isotope Laboratories, MSK-TCA-A) prediluted in 80:20 methanol:water and 50 µl 0.02 ng µl−1 propionyl-l-carnitine-(N-methyl-d3) (Sigma Aldrich, 52941). After vortexing for 1 min, samples were returned to −80 °C for 30 min, centrifuged at 18,000g for 10 min at 4 °C, and the supernatant was transferred to a deep-well 96-well plate and evaporated to dryness under nitrogen gas. Samples were reconstituted in 100 µl, and 2 µl of the sample was injected from a 4 °C autosampler into a ZIC-pHILIC 150 × 2.1 mm 5 µm particle size column (EMD Millipore) with a ZIC-pHILIC 20 × 2.1 guard column in a Vanquish Duo UHPLC system (Thermo Fisher Scientific) at 25 °C. Chromatography conditions were as follows: buffer A was acetonitrile; buffer B was 20 mM ammonium carbonate, 0.1% (vol/vol) ammonium hydroxide in water without pH adjustment, with a gradient of 0.5 min at 20% A, then a linear gradient from 20% to 80% B; 20–20.5 min: from 80% to 20% B; 20.5–28 min: hold at 20% B at a 0.150 ml min−1 flow rate. Column elute was introduced to a Q Exactive Plus with a HESI II probe operating in polarity switching mode with full scans from 70 to 1,000 m/z with an insource fragmentation energy of 1. Acyl-CoA quantification and isotope tracing were measured by liquid chromatography–high-resolution mass spectrometry, as previously described in detail45 with internal standards generated as described46. In brief, samples were quenched in 1 ml 10% (wt/vol) trichloroacetic acid in water for extraction. Samples were homogenized by using a probe tip sonicator in 0.5-s pulses 30 times then centrifuged at 17,000g for 10 min at 4 °C. Supernatant was purified by solid-phase-extraction cartridges (Oasis HLB 10 mg, Waters) that were conditioned with 1 ml of methanol and 1 ml of water. Acid-extracted supernatants were loaded onto the cartridges and washed with 1 ml of water. Acyl-CoAs were eluted with 1 ml of 25 mM ammonium acetate in methanol and evaporated to dryness under nitrogen. Samples were resuspended in 50 µl of 5% (wt/vol) 5-sulfosalicyilic acid and 20-µl injections were analysed on an Ultimate 3000 UHPLC using a Waters HSS T3 2.1 × 100 mm 3.5 µm column coupled to a Q Exactive Plus with a HESI II probe operating in positive-ion mode.
The analysts were blinded to sample identity during processing and quantification. Instruments were controlled using XCalibur v.4.1 and data were analysed on Tracefinder 5.1 using a 5-p.p.m. window from the predominant ion, either positive (carnitines and acyl-CoAs) or negative (all other analytes). The area under the curve for each analyte was normalized to the matched internal standard or the nearest surrogate internal standard. For isotope tracing, isotopologue enrichment was calculated using FluxFix: Isotopologue Analysis tool (v.0.1)47.
Crystal violet assays
... continue reading