Skip to content
Tech News
← Back to articles

LASER couples damage sensing to ESCRT assembly for lysosome repair

read original more articles
Why This Matters

This study reveals how laser-induced damage sensing triggers ESCRT assembly for lysosome repair, highlighting a novel mechanism that could inform therapeutic strategies for diseases involving lysosomal dysfunction. It underscores the importance of understanding cellular repair pathways to develop targeted interventions in the tech and healthcare sectors.

Key Takeaways

Antibodies and chemicals

Reagents were obtained from the following sources: antibodies against HA (3724S, clone C29F4; 1:1,000 dilution for western blot), LC3B (3868S, clone D11; 1:1,000 dilution for western blot), VINCULIN (13901S, clone E1E9V; 1:1,000 dilution for western blot), LAMTOR4 (13140S, clone D4P60; 1:300 dilution for immunofluorescence), HRS (15087S, clone D7T5N; 1:1,000 dilution for western blot), TOM20 (42406S, clone D8T4N; 1:1,000 dilution for western blot), ATG5 (2630S; 1:1,000 dilution for western blot), ATG13 (13468S, clone E1Y9V; 1:1,000 dilution for western blot) from Cell Signaling Technology; LAMP2 (sc-18822, clone H4B4; 1:300 dilution for immunofluorescence), CHMP1A (sc-271617, clone B-5; 1:300 dilution for immunofluorescence) from Santa Cruz Biotechnology; TFG (ab156866, clone EPR8766; 1:300 dilution for immunofluorescence, 1:1,000 dilution for western blot) and NPC1 (ab36983; 1:1,000 dilution for western blot) from Abcam; SEC31A (612350, clone 32; 1:300 dilution for immunofluorescence) from BD Biosciences; SEC31A (17913-1-AP;1:300 dilution for immunofluorescence), TSG101 (67381-Ig, clone 2B7G8; 1:1,000 dilution for western blot), ALIX (67715-Ig, clone 1H9D9; 1:1,000 dilution for western blot), PDCD6/ALG2 (12303-1-AP; 1:1,000 dilution for western blot) from Proteintech; TFG (NBP2-62212, clone TFG-03; 1:300 dilution for immunofluorescence) from Novus; LLOMe (16008) from Cayman; DMSO (D2650-100mL) from Sigma-Aldrich; Pierce Protease Inhibitor Tablets (A32965) from Thermo Fisher; DMEM (11965), DMEM-Phenol Red (31053-028), 0.25% Trypsin-EDTA (25300062), 0.05% Trypsin-EDTA (25300054) from Gibco; U1866A (1638) from Tocris Bioscience; Puromycin (Gibco, A1113803) and Blasticidin (Gibco, A1113903).

CRISPRi cell line generation and validation

K562 sgNT and K562 sgNPC1 cell lines were generated using Cas9–sgRNA ribonuclear protein transfection (sgNPC1 sgRNA sequence: GGACGATCCTTGGCTTGGAC) as previously described26, and knockout was validated by western blot (Extended Data Fig. 1b). In total, 2 × 105 cells were transduced with Ef1a-dCas9-KRAB-BFP construct lentivirus in cell culture medium supplemented with 1 μl ml−1 Polybrene (Millipore Sigma, TR-1003-G). Cells were spinfected at 1,000g for 1 h at room temperature and cultured overnight. Viral supernatant was removed next day and replaced with fresh K562 medium. Cells were expanded and then sorted for BFP+ population on a BD FACS Aria and maintained as a pooled cell line.

To validate CRISPRi efficiency, cells were transduced with lentivirus for guides targeting Gal4 (negative control) or CD55 (cell surface marker). Cells were selected with puromycin (Gibco, A1113803) to obtain a pool of guide containing cells. Cells were incubated with Fc block (Biolegend, 422302) in FACS Buffer (0.5% BSA in PBS) and stained for CD55 (Biolegend, 311312). Knockdown efficiency was analysed by flow cytometry on the Thermo Fisher Attune NxT Flow Cytometer and analysed on FlowJo.

sgRNA guide library plasmid production

The lentiviral expression vector used for CRISPR guide expression is available on Addgene as pLGR1002 (188320). The sgRNA sequences as well as the sgRNA library cloning procedure performed is as described50,51. sgRNA library representation was confirmed by next-generation sequencing.

Guide library lentivirus production and titration

Guide library virus was prepared using the Mega Lentivirus protocol from the Weissman laboratory with modifications (https://weissman.wi.mit.edu/resources/Large_scale_lentivirus_production.pdf). A total of 18 million Lenti-X 293T cells (Takara Bio, 632180) were plated on a 15 cm plate. The next day, transfection mixture was prepared using 125 μl Mirus LT1 transfection reagent (Mirus Bio, MIR2304), 1.5 ml DMEM (Gibco, 11965-092), 18 μg psPax2 (packaging vector), 4 μg MD2G (env expression plasmid, VSVG) and 18 μg of lentiviral plasmid (sgRNA library). Transfection mixture was incubated for 15–20 mins at room temperature. Transfection mix was added to the 293T cells and incubated for 6 h. After 6 h the medium was replaced with fresh 293T medium supplemented with 2 μg ml−1 ViralBoost (ALSTEM, VB100). Lentiviral supernatant was collected 48 h after transfection and filtered (0.45 μm). Lentivirus was stored at −80 °C until use.

Lentivirus titration was performed in K562 cells prior to the screen. Multiplicity of infection (MOI) was determined by percent infection shown by BFP signal via flow cytometry. K562 sgNT and K562 sgNPC1 cells (2 × 105) were transduced with guide library lentivirus in a range of 5–250 μl in K562 medium supplemented with 1 μl ml−1 Polybrene (Millipore Sigma, TR-1003-G). Cells were left in virus for 24 h and then changed to regular medium. Forty-eight hours after infection, cells were analysed on the Attune NXT flow cytometer to determine BFP fluorescence and MOI.

... continue reading