Skip to content
Tech News
← Back to articles

Centromeric footprints preserve telomere integrity in ALT cancers

read original get Telomere Maintenance Kit → more articles
Why This Matters

This study uncovers how centromeric footprints play a crucial role in maintaining telomere integrity in ALT (Alternative Lengthening of Telomeres) cancers, which could lead to new therapeutic strategies targeting telomere maintenance mechanisms in cancer treatment. Understanding these mechanisms is vital for developing interventions against cancers that rely on ALT pathways, potentially improving patient outcomes and advancing precision medicine in oncology.

Key Takeaways

Cell Lines

U2OS (ATCC; HTB-96), Saos-2 (ATCC; HTB-85) and HOS (ATCC; CRL-1543) cell lines were obtained from ATCC. The HeLa (LT, long telomere) cell line was validated using short-tandem-repeat profiling by ATCC’s cell line authentication services. The LM216J/T cells (described initially by J. P. Murnane) were provided by R. Greenberg. U2OS cells with a doxycycline-inducible ATRX allele were provided by D. Clynes26. SV40 large T-antigen immortalized IMR90 control and ATRX-KO ALT IMR90 cells were previously described and provided by H. Zheng and J. Paik8. U2OS cells stably expressing SNAP-tagged CENP-A were provided by G. Almouzni13,29. All of the cell lines were cultured in GlutaMax-DMEM supplemented with 10% bovine growth serum or fetal calf serum, non-essential amino acids and penicillin–streptomycin under 20% O 2 and 7.5% CO 2 at 37 °C. Cell lines were routinely tested for mycoplasma contamination.

Plasmids

Y. Dalal previously described and provided the GFP-tagged HJURP WT plasmid51. The GFP-tagged HJURP deletion mutants, Δ1-80aa and ΔTLTY box42, were generated as variants of this plasmid in this study. D. R. Foltz provided GFP-tagged Mis18BP1 (ref. 52) and YFP-H3CATD (ref. 30). pBabe-SNAP-CENP-A-HA were previously described and provided by L. Jansen13. Flag-tagged TRF1-FokI WT and D450A plasmids were gifts from R. Greenberg37,38. pINDUCER dCas9-TET1-CD plasmids53 were gifts from D. Huangfu (Addgene, 101920 and 101921). Lentiguide-puro54 was a gift from F. Zhang (Addgene, 52963) and used to express sgTel (TTAGGGTTAGGGTTAGGGTT AGG ) for telomere targeting. Underlined bases indicate PAM sequence.

Direct IF analysis

For immunofluorescence (IF) analysis in Figs. 1a and 4a, cells were plated on glass coverslips, washed with PBS and fixed with 2% paraformaldehyde (PFA). After two more washes with PBS, cells were permeabilized (0.05 g of sodium citrate and 0.1% (v/v) Triton X-100) for 5 min, then washed and incubated in a blocking solution (1 mg ml−1 BSA, 10% normal goat serum, 0.1% Tween-20) for 30 min. Cells were incubated with primary antibodies diluted in blocking solution at 4 °C overnight. Next, cells were washed three times and incubated with Alexa-conjugated secondary antibodies (Life Technologies) for 1 h at room temperature. Cells were then washed three times with PBS, fixed using 2% PFA for 10 min and washed twice with PBS. Lastly, cells were dehydrated using a series of ethanol washes (70%, 95% and 100%), air-dried and mounted onto slides with Prolong Gold Anti-fade reagent with DAPI (Life Technologies). Imaging was conducted using conventional fluorescence with a ×60 Plan λ objective using a Nikon 90I.

For all other IF-related experiments, cells were plated onto glass coverslips, washed once with PBS and then permeabilized using cytoskeleton (CSK) buffer (10 mM HEPES, 300 mM sucrose, 100 mM NaCl and 3 mM MgCl 2 supplemented with 0.5% Triton X-100) for 10 min. Cells were then fixed in 2% PFA for 10 min, washed twice with PBS and incubated in blocking solution for 30 min. Primary and secondary antibody incubations were performed as above, and then the cells were fixed, washed, ethanol-dehydrated and mounted. Imaging was conducted with conventional fluorescence using a ×60 Plan λ objective on the Nikon 90I system. Single z stacks (0.5 µm sections) were acquired and analysed. No maximum-intensity projections were used in co-localization experiments. Antibodies used in immunofluorescence: TRF2 (1:1,000, Novus Biologics NB110-57130), TRF1 (1:1,000, Abcam ab10579), PML (1:100, Santa Cruz, SC-966), CENP-C (1:1,000, MBL, PD 030), CENP-T (1:500, Bethyl Laboratories, A302-313A) and Flag M2 (1:1,000, Sigma-Aldrich, F1804).

IF-FISH

After the ethanol dehydration step in IF, coverslips were air-dried. Next, the coverslips were incubated with hybridization mix (70% deionized formamide, 1% maleic acid with 1 mg ml−1 of blocking reagent (Roche), 10 mM Tris-HCl, pH 7.5) containing the appropriate PNA probes at 72 °C for 10 min and then kept in the dark at room temperature overnight. The coverslips were then washed twice for 15 min each with PNA wash A (70% deionized formamide and 10 mM Tris-HCl, pH 7.5) and three times for 5 min with PNA wash B (0.1 M Tris-HCl, pH 7.5, 0.15 M NaCl and 0.08% Tween-20). Ethanol dehydration was performed as described above; the coverslips were air-dried and then mounted in Prolong Gold Anti-Fade reagent with DAPI. Tel (F1004, F1013), CENT (F3003) and CENP-B (F3005) PNA probes were purchased from PNA Bio.

siRNA transfections

... continue reading