Skip to content
Tech News
← Back to articles

Cortical development dynamics across autism spectrum disorder mouse models

read original get Autism Research Brain Kit → more articles
Why This Matters

This study advances our understanding of cortical development in autism spectrum disorder (ASD) by analyzing mouse models, which could inform future therapeutic strategies and improve diagnostic tools. Recognizing the neural development differences in ASD models helps bridge the gap between basic research and clinical applications, ultimately benefiting consumers and the tech industry involved in neurotechnology and diagnostics.

Key Takeaways

Animals

All animals used in this study were approved by the Institutional Animal Care and Use Committee at ISTA and by the Bundesministerium für Bildung, Wissenschaft und Forschung, Austria (approval numbers BMWFW−66.018/0008-WF/II/3b/2014, BMWFW-66.018/0012-WF/V/3b/2015, BMWFW-66.018/0012-WF/V/3b/2017, BMWFW-66.018/0015-V/3b/2019, BMWFW-66.018/0032-V/3b/2019, BMBWF-V/3b/2020-0.342.159, BMBWF-V/3b/2020-0.148.791, BMBWF-V/3b/2021-0.291.172, BMBWF-V/3b/2021-0.291.177, BMBWF-V/3b/2022-0.292.788 and BMBWF-V/3b/2022-0.121.445). All our mutant lines were maintained in a C57BL/6J background. To maintain this background, colonies are continuously refreshed by mating mutants with C57BL/6J animals drawn from a continuously refreshed central C57BL/6J colony. All experiments were performed on mice ranging from E14.5 to P4 and P14. Embryonic time points were determined by plug checks after timed matings, defining E0.5 as the morning post-coitum. Animals were kept in the Preclinical Facility at ISTA, housed in commercially available individually ventilated cages under defined standard laboratory conditions (room temperature 22 ± 1 °C, relative humidity 55 ± 10%) on a 12-h light–dark cycle (lights on at 07:00). Animals were housed in groups of 3–4 animals per cage, with food and water available ad libitum. Experiments were carried out under specific pathogen-free conditions, and the health status of the mouse lines was routinely checked by a veterinarian. All transgenic mouse lines were backcrossed into a C57BL/6J background a minimum of two times. Both females and males were used for experiments.

Generation of constitutive heterozygous mouse lines

Constitutive heterozygous mice (that is, Ash1l+/−, Kdm6b+/−, Kmt5b+/−, Trip12+/−, Usp7+/− and Wac+/−) were generated within the Transgenic Unit at IST Austria in a C57BL/6J background by zygote electroporation of the Cas9 protein (634621, TakaraBio) and custom-made sgRNAs. To generate Ash1l+/− mice, one sgRNA (CAATCACCATTCCGCTATCC AGG) targeting exon 12 of the Ash1l gene was used. For Kdm6b+/−, two sgRNAs (CCCAAGGACCCGAGGTGATA GGG and TACGTATGAGGAGCGAACCC TGG) targeting intronic regions flanking exon 19 of the Kdm6b gene were used. For Kmt5b+/−, two sgRNAs (CCCTCACGACCCTACTACTG TGG and TTTACGTCTCAAGTCACACT GGG) targeting intronic regions flanking exon 9 of the Kmt5b gene were used. Similarly, to generate Trip12+/− mice, two sgRNAs (AGCGTATTCTCACTTTGATC TGG and TAAATTTGTAGAGACAGTTA AGG) targeting intronic regions flanking exon 3 of the Trip12 gene were used. Similarly, for Usp7+/−, two sgRNAs (CTCTCCCGAACATTATGAAG AGG and TGCCACGTCTTATACACATT AGG) targeting intronic regions flanking exon 6 of the Usp7 gene were used. To generate Wac+/− mice, one sgRNA (ATGTCGGAGGCGCAGATGTA GGG) targeting exon 8 of the Wac gene was used.

Superovulation was performed to produce large numbers of zygotes. In brief, 3–4-week-old donor females (in-house) were hormone primed by intraperitoneal injection of 5 IU of pregnant mare serum gonadotropin. Of human chorionic gonadotropin, 5 IU was administered at 46–48 h after pregnant mare serum gonadotropin treatment, followed by 1:1 mating with stud males (in-house). Zygotes were isolated from the oviduct of mated females at 0.5 days post-coitum. M2 with hyaluronidase (MR-051-F, Sigma) was used to dissociate cumulus cells. Zygotes were then cultured in small drops of KSOM (MR-121-D, Sigma) under mineral oil (M-5310, Sigma) at 37 °C and 5% CO 2 , until the electroporation. Electroporation of mouse embryos was performed similarly as previously described63 with the adaptation of using Opti-MEM (31985062, Thermo Fisher) instead of PBS. Finally, F0 founder mice were genotyped using standard PCR amplification with primers 500 bp to 1 kb away from guide RNA-binding sites. F1 mice were generated by backcrossing founder mice with C57BL/6J animals. The F1 mice were again genotyped by PCR, and positive amplicons covering the deleted sequence were Sanger sequenced to confirm precise targeting. All transgenic mouse lines were back-crossed into a C57BL/6J background a minimum of two times, and predicted off-targets were checked. A list of oligonucleotides used is provided in Supplementary Table 1. The constitutive knockout mouse line (HnrnpU+/−) was obtained by mating HnrnpUWT/flox (Hnrnpu<tm1.1Tman>/J, strain: #032187, RRID:IMSR_JAX:032187) mice with a CMV-Cre line (B6.C-Tg(CMV-cre)1Cgn/J; strain #:006054, RRID:IMSR_JAX:006054) and subsequent backcrossings to C57BL/6J WT animals. Crossing of HnrnpUWT/flox mice with homozygous animals of the CMV-CreCre/Cre line results in ubiquitous deletion of one allele of HnrnpU spanning exons 4–14.

Single-nucleus multi-omics profiling of gene expression (snRNA-seq) and chromatin accessibility (snATAC-seq) from the same nucleus (snMultiome-seq)

Sample preparation and nuclei isolation

All the sequenced mutant animals were generated by mating a C57BL/6J female from the continuously refreshed central C57BL/6J colony with a mutant male maintained on the same C57BL/6J background (for example, C57BL/6J female × Ash1l+/− male = litter sequenced). The only exceptions were homozygous Bckdk mice whose heterozygous breeders were regularly refreshed with the same central C57BL/6J colony. Control animals were C57BL/6J × C57BL/6J offspring sourced from the same central colony. Dams used for mutant and control litters were drawn from the same central-colony cohorts and often littermates; at minimum, they were not separated by generations of inbreeding.

Brain tissue (forebrain and cerebellum) from E14.5, P4 and P14 mice was used for snMultiome-seq experiments. Animals coming from at least three separate litters were collected to avoid potential litter-specific biases. For the embryonic time point (that is, E14.5; n = 3 per genotype + sex), timed-pregnant females were decapitated, and embryos were rapidly dissected on ice. Cortical tissue was dissected in ice-cold PBS, meninges were removed, and forebrain structures were snap-frozen in liquid nitrogen and stored at −80 °C until nuclei isolation.

For postnatal time points (that is, P4 and P14; n = 3 per genotype + sex + time point), mice were decapitated, the brain was rapidly dissected on ice and subcortical structures were removed. The remaining forebrain (cortex + hippocampus) and cerebellum were separately snap-frozen in liquid nitrogen and stored at −80 °C until nuclei isolation.

... continue reading