GoKawiilBacterial strains
All strains for the experiments were grown in lysogeny broth (LB) Lennox and the required antibiotics and incubated at 37 °C with shaking. E. coli K-12 (BW25113)72 was used for most biological analyses, and the BL21-AI or NEB5α strains were used for protein purification and cloning, respectively. The use of the ECOREF53 strain collection is described in detail in later sections. When culturing strains transformed with plasmids, the following antibiotic selection was used: 100 μg ml−1 spectinomycin, 25 µg ml−1 chloramphenicol and 100 μg ml−1 kanamycin.
Phages
Phage T7 WT was acquired from DSMZ, T7Δ0.7::cmk (referred to as Δ0.7 throughout the manuscript) was a gift from U. Qimron73. Our phage stocks were checked for the presence of the correct T7 genotype with the primers TAGCCAACACACTGAACGCT and CACCCGCAGATGACCTGTAA for T7 WT and TAGCCAACACACTGAACGCT and GCCAAAAGGCGCTCAAAGTT for T7Δ0.7::cmk. Moreover, we confirmed that the known deletion mutant H1 (ref. 74) did not occur in our stocks (using the primers TAGCCAACACACTGAACGCT, CACCCGCAGATGACCTGTAA and GCCAAAAGGCGCTCAAAGTT). Two mutants of T7, the catalytic dead G76F35 and a truncated kinase mutant ΔSO (kinase domain only, residues 1–242), were generated using in vitro methods for genome engineering and cell-free phage rebooting using proprietary methods developed by Invitris. Phages from the BASEL collection59 (Bas64, Bas65, Bas66(T3K12), Bas67 and Bas68) were a gift from A. Harms. Note that the infection curves of our Bas67 stock behaved significantly differently to the other BASEL Autographiviridae, so we excluded this phage from further analyses. Phage P1vir was single-plaque purified from a Typas laboratory stock. Annotated genomes were downloaded from the NCBI using the GenBank accessions as reported in ref. 59 and NC_047864.1 (reference genome used to represent T3/Bas66(T3K12)) and NC_005856.1 (reference genome used to represent P1vir).
Phages were propagated in the E. coli K-12 (BW25113) strain and cultured in LB, 5 mM CaCl 2 and 10 mM MgCl 2 at 37 °C with shaking. Lysates of overnight cultures infected with phage stocks were prepared by adding chloroform, vortexing and centrifuging (4,000g, 4 °C, 5 min) to remove debris. The lysate was transferred to fresh tubes, additional chloroform was added, and the samples were vortexed and centrifuged again. Clarified lysates were stored at 4 °C. Lysate titres were determined in duplicates using the double-agar overlay method75.
Plasmids
For the study of recombinant T7K, the regions encompassing the N-terminal PK domain (residues 1–242) and the C-terminal SO domain of T7K (residues 243–359) were PCR-amplified from T7 gDNA using Q5 High-Fidelity DNA Polymerase (NEB), with primers designed to introduce a 6×His-TEV N-terminal fusion and carrying overhangs to plasmid pET28a.
Almost all plasmids used in the T7K screen (Supplementary Table 5) are in the pTU175 backbone, which carries the low-copy-number origin of replication pSC101, except for the Borvo and Retron-Eco8 defence systems, which were obtained from the lab of Rotem Sorek and kept in the pSG1-vector, expressed from their native promoter and with a p15a origin of replication48,52, and CmdTAC (PD-T4-9) defence system, which was obtained from the laboratory of M. Laub, and was kept on its original plasmid pCD1–PD-T4-9 under its native promoter76. Plasmids containing Retron-Eco1, Retron-Eco9 and Retron-Sen2 have been described previously33. For Retron-Eco3, Retron-Eco6 and Retron-Eco10, the retrons were amplified with their native promoters (500 bp upstream of the retron start) from strains from the ECOREF E. coli natural isolate library53 or from strain SC402 (Retron-Eco3), and cloned into pTU175. For the toxin–antitoxin system TacAT77, the protein-coding sequence was amplified from Salmonella typhimurium LT2 and cloned into the pTU175 backbone under the arabinose-inducible pBAD promoter. The HEPN-MNT78 and the ApeA49 defence systems were cloned into the pTU175 vector under the arabinose-inducible pBAD promoter (gift from I. Songailiene, V. Šikšnys laboratory). The DarTG1 defence system was cloned into the pTU175 vector under the arabinose-inducible pBAD promoter by M. LeRoux79.
Phosphomimetic mutant constructs of RcaT (in Retron-Eco9) and DarT (in DarTG1) were generated using the Q5 site-directed mutagenesis kit (NEB), using the primers described in Supplementary Table 6. Plasmid edits were confirmed by Sanger sequencing and PacBio whole-plasmid sequencing.
Infection sampling (single timepoint)
... continue reading