Animals
Experimental procedures involving the use of mice were carried out following the ethical guidelines established by the Biosafety and Animal Welfare Committee at CICbioGUNE, under ethics protocol P-CBG-CBBA-0121. The procedures were performed in concordance with the recommendations stablished by the AAALAC. Mice on a mixed background were housed under controlled environmental conditions, such as time-controlled lighting on standard 12 h:12 h light:dark cycles, controlled temperature at 22 ± 2 °C and 30–50% relative humidity. Mice were fed regular chow diet ad libitum and fasted for 6 h prior to tissue collection (09:00–15:00) to prevent metabolic alterations due to immediate food intake. At the experimental end-point, all mice were euthanized by CO 2 inhalation followed by cervical dislocation.
Sf3a3 KI/KI mouse generation
To engineer Sf3a3KI/KI mice, zygotes were obtained from crosses between C57Bl6 male mice and hybrid C57Bl6.CBA female mice. Zygotes were injected with Cas9 and a guide RNA (gRNA) (Cr/Trac) targeting the sequence of interest and a repair single-stranded oligonucleotide containing the intended mutations flanked by 80 bp of homology arms adjacent to the double-strand break site. Genotyping was performed by specific amplification followed by Sanger sequencing. The single guide RNA (sgRNA) used was GATCAGCGAGAGCGAAAGTGAGG and the repair single-stranded oligonucleotide was GAACAGCGACAGCTCACTCATGAAAATGTTCAGCGCAAGCAAGCCAGGACAGGCGAGGAGCGGGAGGAGGAGGAGGAGGAGCAGATCGCCGAGGCAGAAGCTGAAGACGAAGAGAATGAGATCATTTACAACCCCAAGAACCTGCCGCTGGGCTGGGACGGCAAGGTAAGGTCTCAGGGCCCTCTGTCCCCTTCCATCATGGGCATGCCTGAGCTCGGAAATCTCATGCAGTCGCTTTCCTTTAGCCCATCCCCTACTGGCTGTAC. All CRISPR reagents were purchased from Integrated DNA Technologies. gRNA was assembled from Alt-R CRISPR–Cas9 CRISPR RNA (crRNA; 5′-GATCAGCGAGAGCGAAAGTG-3′) and Alt-R CRISPR–Cas9 trans-activating crRNA (tracrRNA) in microinjection buffer (10 mM Tris/HCl pH 7,5; 0.1 mM EDTA) by heating for 5 min at 95 °C in a thermocycler and decreasing temperature slowly using a pre-defined temperature ramp. Assembled tracrRNA and crRNA gRNAS were incubated with Alt-R SpCas9 Nuclease V3 to form the ribonucleoprotein complex for 15 min at room temperature in microinjection buffer and injected at a final concentration of 1.2 µM and 0.24 µM, respectively. Donor oligodeoxynucleotide was added at a final concentration of 10 ng μl−1.
CRISPR reagents (Integrated DNA Technologies) were microinjected in the pronucleus of zygotes obtained from crosses between C57Bl6 males and hybrid B6.CBA female mice. Female mice (5–8 weeks of age) were previously superovulated by consecutive administration of 5 IU of pregnant mare serum gonadotropin (PMSG) (at 15:00 of day −3) and 5 IU of human chorionic gonadotropin (hCG) (at 13:00 of day −1), and matings were set up immediately after hCG administration. At 8 pm of day 0, the formation of vaginal plugs was monitored and cumuli were collected from oviducts. Cumuli were disaggregated with a hyaluronidase (Sigma H4272) solution (10 mg ml−1 in M2 medium) diluted 1:2 in M2 medium at the moment of treatment. Free zygotes were cultured in KSOM medium until injection. On the next day, zygotes that had developed to the 2-cell stage were transferred to pseudopregnant CD1 female mice according to standard protocols34.
Reagents
The human prostate carcinoma cell lines used were purchased from Leibniz-Institut DSMZ (Deutsche SammLung von Mikroorganismen und Zellkulturen GmbH), which provided authentication certificates: DU145 (ACC261), PC3 (ACC465), 22RV1 (ACC438) and human benign prostatic hyperplasia (BPH-1) (ACC143). WPMY-1 prostate stroma fibroblast cell line was purchased from ATCC (CRL-2854). Virus packaging cell line (HEK 293FT; Invitrogen) was provided by R. Barrio and J. Sutherland. Human breast cancer cell lines were purchased from DMSZ: MCF7 (ACC115) and MDA-MB-231 (ACC732). Human melanoma cell line A375 was purchased from ATCC (CRL-1619). J. Valcarcel provided the HeLa cervical carcinoma cell line. SKNBE2 cell line were provided by the Children’s Oncology Group Cell Culture Repository (https://cccells.org) with authentication certificates. In all the cases cells tested negative for mycoplasma. DFMO (prepared in water, final concentration 25–500 µM), doxycycline (prepared in water, final concentration 0.1–0.15 µg ml−1), pladienolide B (prepared in DMSO, final concentration 10 nM), Spd (prepared in water, final concentration 0.3–10 mM for kinase assay and 10 µM for other assays), Spm (prepared in water, final concentration 0.3–10 mM for kinase assay and 10 µM for other assays), Put (prepared in water, final concentration 0.3–30 mM for kinase assay and 10 µM for other assays), BENSpm (prepared in water, final concentration 0.3–3 mM for kinase assay and 10 µM for other assays), synthetic Spd photoaffinity probe (prepared in water, final concentration 5 µM), aminoguanidine (prepared in water, final concentration 1 mM), SAM486A (prepared in water, final concentration 0.1–5 µM in vitro, 10 mg per kg (body weight) per day intraperitoneally for 8 days, in vivo), thymidine (prepared in water, final concentration 2 mM), CX4945 (prepared in DMSO, final concentration 10 µM) were obtained from Sigma-Aldrich (doxycycline, thymidine, aminoguanidine, Spd, Spm and Put), SCBT (pladienolide B), Tocris (DFMO and N1,N11-diethylnorspermine) and LabNet Biotecnica (CX4945), and SAM486A was provided by Novartis. [U-13C 5 ] l-methionine was purchased from Cambridge Isotope Laboratories and dosed at a final concentration of 30 μg ml−1 in vitro. Doxycycline was used at 100 ng ml−1 for silencing of AMD1, and 150 ng ml−1 for silencing of ODC1, DHPS and EIF5A1. shRNA targeting AMD1 was purchased from Sigma (TRCN0000078460) and described elsewhere3. shRNA targeting ODC1, DHPS and EIF5A1 were purchased from Sigma (TRCN0000333342, TRCN0000045644 and TRCN0000062548, respectively). The control shRNA sequence was CCGGCAACAAGATGAAGAGCACCAACTC|GAGTTGGTGCTCTTCATCTTGTTG35. Sub-cloning of shODC1, shDHPS and shEIF5A1 into pLKO-Tet-On vector were done introducing AgeI and EcoRI in the 5′ end of top and bottom shRNA oligonucleotides, respectively (TET-pLKO puro was a gift from D. Wiederschain36 (Addgene plasmid #21915)). Lentiviral transductions were performed as previously described3. siRNAs for transient transfections were purchased from Dharmacon and used at a final concentration of 25 nM (siScr: D-001810-10-05, siAMD1; L-010053-01-0005, siSF3A1; L-016051-00-0005, siSF3A3; L-019808-00-0005, siSF3B1; L-020061-01-0005).
Cellular and molecular assays
Cell number quantification for growth curve and focus assays was done with crystal violet3. DU145 cells submitted to hypoxic conditions were incubated in hypoxia incubator (Baker) at 1% hypoxia for 24 h. Polyamine supplementation experiments were complemented with 1 mM aminoguanidine to avoid polyamine oxidation in media. Western blot was performed as previously described3, run in NUPAGE gradient precast gels (Life Technologies) in MOPS buffer. Primary antibodies were used at 1:1,000. Anti-AMD1 (11052-1-AP, Proteintech); anti-ODC1 (17003-1-AP, Proteintech); anti-PAOX (18972-1-AP, Proteintech); anti-SAT1 (10708-1-AP, Proteintech); anti-SMOX (15052-1-AP, Proteintech); anti-CK1 (2655, CST) and anti-HSP90 (4874S, CST). Secondary anti-rabbit antibody was used at 1:4,000 and purchased from Jackson ImmunoResearch. RNA was extracted using NucleoSpin RNA isolation kit from Macherey-Nagel (ref: 740955.240 C) or automatically extracted using Maxwell RSC instrument (Promega) according to the manufacturers’ instructions (Supplementary Methods).
RNA-seq analysis
... continue reading