Animals
All animal work was conducted in compliance with animal ethics committees at the Peter MacCallum Cancer Centre (PMCC), the University of Melbourne, Monash University, the University of Queensland and Institutional Animal Care and Use Committee at Weill Cornell Medical College.
Zebrafish
The following published transgenic lines were used at the stages indicated in the figures: Tg(kdrl:EGFP)s843 (ref. 46); Tg(fli1a:nEGFP)y7 (ref. 47); Tg(−5.2lyve1b:DsRed)nz101 (ref. 48); Tg(14xUAS:NfsB-mCherry)c264 (ref. 49); Tg(lyve1b:ERK-KTRClover)uom117; Tg(kdrl:Hsa.HRAS-mCherry)s916 (ref. 50); Tg(mpeg1.1:gal4FF)gl25 (ref. 51); TgBAC(lamp2-RFP)pd1044 (ref. 52); Tg(adamts3:GAL4FF)mu400 (ref. 53); Tg(ccbe1:mCitrine)hu6741 (ref. 53); Tg(vegfc:GAL4FF)mu402 (ref. 53); Tg(5xUAS:EGFP)zf82 (ref. 54); Tg(lyz:BFP)zf217Tg (ref. 55) and Tg(mpeg1.1:TagBFP)bcz53Tg (ref. 56). flt4um203 mutants were previously published in ref. 57 and were used at the stages indicated.
Shark, axolotl, chicken, fat-tailed dunnart and mouse
Tissue samples were collected from stage 38 axolotl (Ambystoma mexicanum) larvae and prehatching epaulette sharks (Hemiscyllium ocellatum) at Monash University. Samples from chicken embryos were collected at 10 dpf at the University of Melbourne. Mouse brains from 6-month-old mice were collected at the PMCC. Following euthanasia mice were perfused with PBS transcardially by means of injection through the right ventricle. Brains and abdominal organs were collected from 1-year-old fat-tailed dunnarts (Sminthopsis crassicaudata) during postmortem dissections at the University of Melbourne.
Transgenesis
The osr2 targeted knock-in line Ti(osr2int2-Gal4vp16/4xnrUAS-mTagBFP2) was generated using the CRISPR–Cas9 Insertional Mutagenesis Protocol and tool kit58. CRISPR RNA (crRNA)(tacatcacacttttaccccg GGG, PAM sequence in uppercase) targeting the second intron of the Osr2 gene was designed using the IDT online tool (https://sg.idtdna.com/site/order/designtool/index/CRISPR_CUSTOM). A solution containing the pSA1-T2A-Gal4vp16_synCoTC/4xnrUAS-mTagBFP2 plasmid (17 ng μl−1), precomplexed guide RNAs (gRNAs) (Alt-R) targeting the Osr2 intronic sequence (6 μM) and plasmid (3 μM) and Cas9 protein (Cas9 HiFi v.3, Integrated DNA Technologies) was injected into one-cell stage zebrafish eggs. Injected embryos were screened for mTagBFP2 fluorescence, raised to adulthood and outcrossed with wild-type zebrafish to identify founders. Cassette integration in the genome was confirmed by PCR and Sanger sequencing using the following primers:
mTagBFP2 forward: AGCTGGGACACAAGCTGAAT
osr2 reverse: TCTGAGGAACAGGCGAGAG
... continue reading