Skip to content
Tech News
← Back to articles

ZFTA–RELA ependymomas make itaconate to epigenetically drive fusion expression

read original get Epigenetic Drive → more articles

Cell lines and culture methods

All cell lines were cultured in a humidified incubator under normoxia at 37 °C with 5% CO 2 . Cell lines were validated by STR analysis and were routinely screened and tested negative for mycoplasma.

Mouse cell lines

Immortalized mNSCs were provided by R.J.G.62. RCAS-TVA control (NS-1, NS-2 and NS-3) cell lines or mouse tumour cell lines with the ZFTA–RELA fusion (H-57, H-41 and H-59)12 were provided by E.C.H. Mouse cells were cultured in neurobasal medium (Gibco, 21103049) with 0.2% heparin solution (StemCell Technologies, 07980), 20 ng μl–1 EGF (Shenandoah, 100-26) and 20 ng μl−1 FGF-basic 154aa (Shenandoah, 100-146).

Patient-derived cell lines

EP1NS (ZFTA–RELA+) cells were obtained from T. Milde63. EPD-210 (PFA) cells were obtained from the Brain Tumour Resource Laboratory, Fred Hutchinson Cancer Research Center. Both cell lines were grown in neurobasal medium without vitamin A (Thermo Fisher, 12587-010) with 0.2% heparin solution, 20 ng μl–1 EGF and 20 ng μl–1 FGF-basic 154aa (Shenandoah, 100-146). ST-1 (ZFTA–MAML3+), ST-2 (ZFTA–RELA+) and ST-4 (ZFTA–RELA+, CDKN2A−/−) cells were provided by K.A.M. The cell lines were cultured in neurobasal medium without vitamin A supplemented with Glutamax (Thermo Fisher Scientific, 35050-061), 200 µg ml–1 human EGF and 4 µg ml–1 human FGF and 0.2% heparin in T-75 flasks coated with poly-l-ornithine solution (Sigma-Aldrich, P4957) and laminin from Engelbreth–Holm–Swarm murine sarcoma basement membrane (Sigma-Aldrich, L2020). The CPITT-1 (ZFTA–RELA+) cell line was provided by S.A. and was cultured in neurobasal medium supplemented with 0.2% heparin solution, 20 ng μl–1 EGF and 20 ng μl–1 FGF-basic 154aa. EPN1425 cells were provided by S. Mack and were cultured in DMEM medium (Gibco, 11965092) supplemented with 10% fetal bovine serum (VWR, 89510-186) and 200 mM l-glutamine (Thermo Fisher Scientific, A2916801). MAF-1329 (ZFTA–RELA+) and MAF-811 (PFA) cell lines were provided by A.G. and N.K.F. and were cultured in Opti-MEM media (Gibco, 31985070) supplemented with 10% fetal bovine serum and 200 mM l-glutamine. All cell lines were cultured in media supplemented with penicillin–streptomycin (10,000 U ml–1) (Thermo Fisher Scientific, 115140122) and plasmocin prophylactic (InvivoGen, antmpp).

Lentiviral-transduction-mediated gene silencing using shRNA

Isogenic mNSCs were generated by transfecting cells with ZFTA WT, RELA WT, ZFTA–RELA or EV backbone4 using lentiviral particles (SBI LentiStarter 3.0 kit, V060A). The following lentiviral transfection protocol was used to express ZFTA WT, RELA WT, EV or ZFTA–RELA (which contains 200 bp upstream of the initiating start codon) plasmids into immortalized mNSCs. Similarly, the same protocol was used to knockdown genes with shRNAs. First, 2 × 106 HEK293T cells were plated on 100 mm dishes 36–48 h before transfection. A change of medium was performed the next day to a volume of 5 ml antibiotic-free medium. All lentiviruses were prepared using a Lentistarter 3.0 kit (System Biosciences, LV060A-1). In brief, 2 μg transfer DNA (shACOD1), 20 μg pPackH1 mix and 24 μl PureFection reagent were mixed in 500 μl serum-free DMEM medium and incubated at room temperature for 30 min. The mixture was added dropwise to HEK293T cells and gently swirled to distribute. The transfected cells were then incubated at 37 °C and 5% CO 2 to produce virus for 48 h. During this period (around 48 h before intended infection), 1 × 106 ZFTA–RELA mNSCs or EP1NS cells were plated in T-75 flasks. Lentiviral particles were then collected and filtered using a 0.45 µm PVDF filter. Next, lentiviral particles were evenly distributed onto target cells. Lentiviral medium was removed after 24 h and replaced with suitable ZFTA–RELA mNSC or EP1NS cell culture medium. After 48 h, the transfected cells were treated with the appropriate antibiotic for selection. EP1NS cells were treated with 2 μg ml–1 puromycin, whereas ZFTA–RELA mNSCs were selected using 15 μg ml–1 blasticidin. Lentiviral plasmids used for shRNA-mediated knockdown are as follows: shAcod1 (mouse, access ID: NM_008392.1) (Gentarget) and shACOD1 (human) (Horizon Discovery). The following sequences were targeted to knockdown Acod1 in ZFTA–RELA mNSCs: shAcod1-1 (GAGAGCTTTGCTGGTATGATT) and shAcod1-2 (GAGGCATTGGCTATTGCTGTT).

The following sequences were targeted for knocking down ZFTA–RELA in EP1NS (ZFTA–RELA+) cells. The following ZFTA–RELA shRNAs were custom-designed and obtained from Gentarget: shZFTA Fus-1, GCTTGCCCGCCCAAGGGCCCA; shZFTA Fus-2, AGGGCCCAGAACTGTTCCCCC; and shZFTA Fus-3, CAGAACTGTTCCCCCTCATCT.

Human ACOD1 lentiviral cDNA (NM_001258406) and scrambled vector controls were purchased from Origene (SKU RC232825L4).

... continue reading