GoKawiilMouse lines
All experiments were conducted in compliance with the Association for Assessment of Laboratory Animal Care policies and approved by the Institutional Animal Care and Use Committees of the University of Virginia, University of Washington and University of California, Irvine. Mice were housed on a 12-h:12-h light–dark (LD) cycle with food (PicoLab Rodent Diet 5053) and water provided ad libitum unless otherwise indicated. For experiments, we used 8-week or older male and female C57BL/6J mice, Glp1r-IRES-Cre mice (Glp1rtm1.1(cre)Lbrl/RcngJ, strain 029283, RRID: IMSR_JAX:029283), Glp1r-IRES-Cre mice crossed to the Ai14 tdTomato reporter line (B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J, strain 007914, RRID: IMSR_JAX:007914), Glp1rflox/flox mice (B6(SJL)-Glp1rtm1.1Stof/J, strain 035238, RRID: IMSR_JAX:035238), Dat-Cre mice (B6.SJL-Slc6a3tm1.1(cre)Bkmn/J, strain 006660, RRID: IMSR_JAX:006660) Gcg-Cre mice (C57BL/6J-Tg(Gcg-cre)-1Mmsc/Mmmh, stock 051056-MU, RRID: MMRRC_051056-MU) and Glp1rS33W mice (described below). Gcg-Cre mice were rederived by in vitro fertilization from frozen sperm (MMRRC, 051056-MU). Approximately equal numbers of males and females were used per group unless otherwise specified.
Generation of Glp1r S33W mice
The Glp1rS33W mouse line was generated by CRISPR–Cas9 homologous repair at the University of Virginia Genetically Engineered Murine Model Core. In brief, Cas9 (Alt-R S.p. Cas9 Nuclease V3, 100 µg, 1081058), Alt-R HDR Donor Oligo repair template (see subsection below), tracrRNA (Alt-R CRISPR–Cas9 tracrRNA, 5 nmol, 1072532) and CRISPR–Cas9 crRNA XT (ATTTCTGCACCGTCTCTGAG) were microinjected into a fertilized B6SJL zygote and implanted into a pseudopregnant female. Founder pups were genotyped as described below and backcrossed to C57BL/6J mice for at least four generations before experimentation. This strain will be available at The Jackson Laboratory Repository with the JAX 040551 Glp1rS33W mouse line.
Repair template
aagagggtgggagtccagtgggaccagaggggctgctggagccacggggcttctgcttttatttctgctttcccttgtagGGTACCACGGTGTCGCTC TGG GAAACCGTCCAAAAGTGGAGAGAATACCGGCGGCAGTGCCAGCGTTTCCTCACGGAAGCGCCACTCCTGGCCACAGgtgcgtccagatgaggcctcacg. Lowercase: non-coding regions; uppercase: coding regions; bold: mutated region; underline: codon coding for S33W mutation.
Validation of Glp1rS33W mice
Tail snips were obtained from pups at 3 weeks of age. DNA was extracted with an extraction buffer (Sigma, E7526) and tissue prep solution (Sigma, T3073), heated for 10 min and 3 min at 55 °C and 100 °C, respectively, then neutralized with a neutralization solution (Sigma, N3910). PrimeSTAR High Fidelity PCR (Takara, R050A) was performed with 1 µl cDNA and 10 µM 5′–3′ F (GATCCCCAAAGTGGCAGTCA) and 5′–3′ R (AGCTATGGACTGGGGATCGT) primers. After amplification, the PCR product was run on a 1.2% agarose gel and bands were cut out at 330 bp. DNA was gel-extracted and purified (QIAGEN, 28704), mixed with 5 µM right primer, H 2 O, and subsequently sent to be analysed by Sanger sequencing (Azenta). Chromatogram results were analysed to assign WT, heterozygous or homozygous genotypes for each mouse.
Generation of GLP1R viruses
The full-length human GLP1R gene was obtained by PCR, amplifying the human fragment from GLP1R-Tango (plasmid from Addgene, 66295, RRID: Addgene_66295), including the leader sequence present in the GLP1R-Tango. The primers used were: 5′–3′ F (AAAGCTAGCGCCACCATGAAGACGATCATCGCCCTGAGC) and 5′–3′ R (TTTGGCGCGCCCTAA-GAGCAGGACGCCTGACAAGT), ligating the product into pAAV-hSyn-DIO-EGFP (plasmid from Addgene, 50457, RRID: Addgene_50457) in place of the EGFP in NheI and AscI sites to produce the human GLP1R virus construct (AAV-hSyn-DIO-hGLP1R). The full-length mouse Glp1r WT gene was synthesized by Twist Biosciences, generating an NheI and an AscI fragment. This construct included the same leader sequence present in the human construct, as well as an HA tag encoded at the C terminus of the full-length mouse protein-coding region. The fragment was inserted into pAAV-hSyn-DIO-EGFP (plasmid from Addgene, 50457, RRID: Addgene_50457) in place of EGFP to produce the plasmid construct (AAV-hSyn-DIO-mGLP1R-HA). The full-length mouse Glp1r gene bearing a Ser-to-Trp mutation at position 33 (S33W) was made by inserting a synthetic NheI and StuI fragment prepared by Twist Biosciences, containing the single mutation within this fragment. This was cloned into the sites present in the WT construct to produce the S33W mouse mutant, followed by an HA tag encoded at the C terminus (AAV-hSyn-DIO-mGLP1RS33W-HA). Viral plasmid constructs were confirmed by Sanger sequencing. Virus plasmid constructs were prepared and sent to the University of North Carolina Viral Core for preparation of the AAV (serotype 8). In experiments using AAV-DIO-hGLP1R, AAV-DIO-mGlp1r-HA and AAV-DIO-mGLP1RS33W-HA to drive receptor expression, viral titres were carefully calibrated to approximate endogenous receptor levels (Supplementary Fig. 5b); nonetheless, this overexpression approach might alter receptor distribution or signalling, and constitutes a limitation of the model.
... continue reading