Cell culture
The human U2OS osteosarcoma cell line (ATCC, HTB-96), HeLa Kyoto cervical carcinoma cell line (CVCL_1922), primary immortalized retinal epithelial cell line hTERT-RPE1 (ATCC, CRL-4000), primary immortalized foreskin fibroblast BJ cells (ATCC, CRL-2522) and their derivatives were grown in Dulbecco’s modified Eagle’s medium (DMEM, high glucose, Glutamax) containing 10% fetal bovine serum (FBS) and penicillin–streptomycin antibiotics (Thermo Fisher Scientific). The E14-derived mouse ES cell lines were obtained from P.-A. Defossez. The J1 mouse ES cell line and PAF15KRKR mutants were obtained from S. Bultmann and H. Leonhardt. Mouse ES cells were cultivated in ESC medium (DMEM (Gibco), 15% KnockOut Serum Replacement (Gibco), 1 mM sodium pyruvate (Gibco), 1× non-essential amino acids (Gibco) and 100 U ml−1 penicillin–streptomycin, 2 mM l-glutamine (Life Technologies), supplemented with LIF (mouse leukaemia inhibitory factor, 10 ng ml−1; Miltenyi) and 0.1 mM β-mercaptoethanol (Sigma)). All cell lines and their derivatives were cultured under standard cell culture conditions (37 °C with 5% CO 2 , humidified atmosphere). Cells were routinely tested for mycoplasma contamination (MycoAlert, Lonza) and were always negative.
Chemical reagents
Reagents were as follows: hydroxyurea (ribonucleotide reductase (RNR) inhibitor; Sigma-Aldrich, H8627; solubilized in H 2 O), ceralasertib (AZD6738) (ATR inhibitor; Selleckchem, S7693), adavosertib (MK-1775) (WEE1 inhibitor; Selleckchem, s1525), palbociclib (PD-0332991) (CDK4/6 inhibitor; Selleckchem, S1116), MG132 (proteasome inhibitor; Selleckchem, s2619), bortezomib (proteasome inhibitor; Selleckchem, S1013), PDD 00017273 (PARG inhibitor; Tocris, 5952), doxycycline (Thermo Fisher Scientific, BP2653-5), T2AA (PCNA inhibitor; Tocris, 4723), nocodozole (Tocris, 1228), 5-chloro-2′-deoxyuridine (CldU; Sigma-Aldrich, c6891), 5-iodo-2′-deoxyuridine (IdU; Sigma-Aldrich, I7125), olaparib (PARP inhibitor; Selleckchem S1060), decitabine (DNMT1i; Tocris, 2624), PHA-767491 hydrochloride (CDC7 inhibitor; Tocris, 3140), 5-Ph-IAA (Merck, SML3574) and 5-ethynyl-2′-deoxyuridine (EdU; Thermo Fisher Scientific, A10044). The drugs were reconstituted in DMSO and were used as indicated in the figure legends.
Generation of knockout and complementation cell lines
Knockout of the PAF15 gene in U2OS, HeLa Kyoto and hTERT-RPE1 cells was done using a single guide RNA (gRNA) (targeting exon 2, GGCTGCTCGAGCCCCCAGAA) cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid 62988, a gift from F. Zhang) via the BbsI restriction site, followed by transfection with Lipofectamine LTX Plus. After two days, transfected cells were selected in medium containing 1–8 µg ml−1 puromycin (InvivoGen, ant-pr-1). After 30–40 h, transfected cells were recovered in plain medium and serially diluted into single cells per well of a 96-well plate to obtain single colonies, expanded and tested for knockout efficiency by immunofluorescence of PAF15 using high-content imaging (QIBC) screening, western blotting and Sanger sequencing of gRNA targeting sites. Only cell lines that passed all validation steps were used. Clones with successful knockout of PAF15 were selected for phenotypic validation. A similar approach was used, by transfecting p53 (also known as TP53) single gRNA (PX459-TP53-exon4, Addgene plasmid 217455, a gift from J. Diffley) or in combination with PX459-PAF15-exon2 (this paper) to generate p53 knockout or p53 + PAF15 double knockout in hTERT-RPE1 cells.
Constitutive and T-REx-inducible cell lines
For complementation assays with constitutive expression, PAF15-KO U2OS cell lines were transfected with the following variant plasmids: PAF15wt-1×MYC-1×-Flag-tag (Origene, RC200694), PAF15 PIP-box mutant (F68F69 to AA mutation)-1×Flag or PAF15 KEN-box mutant (K78A mutation)-1×Flag. Appropriate DNA constructs were transfected using Lipofectamine LTX Plus reagent in PAF15-KO cells. Transfected cells were serially diluted into single cells per well of a 96-well plate to obtain single colonies under selection with DMEM containing geneticin (Gibco, 10131-027) for 12 days. Individual colonies were expanded and tested by immunofluorescence, using QIBC for C terminus Flag-tag or MYC-tag PAF15 (cellular localization), and expression level was tested by western blotting, using antibodies against PAF15.
All of the inducible cell lines were generated through tetracycline-regulated expression of the gene of interest, using T-REx (Thermo Fisher Scientific, K102002). U2OS PAF15-KO cell lines were introduced with doxycycline inducible of each PAF15 wt-1×Flag, PAF15 PIP-box mutant-1×Flag, PAF15 KEN-box mutant-1×Flag, and ΔPAF15 variants (2–11 amino acid deletion) were cloned into the doxycycline-inducible expression vector pcDNA4/TO. PAF15 variant constructs cloned in pcDNA4/TO were co-transfected with the pcDNA6/TR plasmid (expression vector for Tet repressor) by Lipofectamine LTX Plus reagent (Thermo Fisher Scientific, 15338-100). After two days, transfected cells were selected in DMEM supplemented with 10% FBS containing blasticidine and zeocine (Thermo Fisher Scientific; blasticidine, A1113902; zeocine, R25001). After reaching 60–70% confluency, cells were serially diluted into single cells per well of a 96-well plate to obtain single colonies, expanded and tested for PAF15 induction after doxycycline treatment by QIBC, western blotting and high-resolution microscopy.
PAF15 degron cell line
... continue reading